Loading...
The URL can be used to link to this page
Your browser does not support the video tag.
Home
My WebLink
About
Record of Accounts 1919-1923 (2)
North Carolina, ) | BALANCE DUE THE ESTATE. 4 i if ty ) oem 2950.17 »L068.50 i 14) Tredell County. i s i if} CREDIT BY SPECIAL VOUCHERS. ; baa : nih In the matter of F. A. Sherrill, ) 1. F. A. Sherrill, father 3930.17 | f ) leila Public Laws 1911, Ch. 172 NE Pg ee ; ; P ‘IT NAL TTLEMENT. . ii Administrator of the Estate of ' F ob IME ae Hy) “he administrator for the purpose of explaining the amount of the na Avery N. Sherrill. ) 3 | | nahh Clerk s costs calls attention to the fact that the note and shares o the Hale : : f Ht et ee ee oe eee eee Building & Loan stock, as well as the corporate stock, were not convetted \ | : + 4 *\A Magy . : ud nih Pr. A. Sherrill, administrator of Avery N. Sherrill, respectfully returns into money by him but were simply transferred to his use he aiiniadas i { i o + “~ Lhe . if 2 MMIII SS a an low is st, true and complete state- at iva ; ws 4 th and shows, uvon oath, that the following is a just, ’ Pp . trator advanced whatever meney was necessary to pav the ebts and took the he i ti Vv j ‘ ii 4 vn ‘ tka » iS fe a ; Aa m all transactions had by him in the discharge of his trust: property. Under the Revenue Act of 1911. the net. a, | Be i} -_s ig : +7il, tne net amount of the e: tate i] t M AT CIT. ; uli CHARGES. being less than *2000.90 no inheritance tax is collectable. aye le Ha vada ide = at) To cash received from Hurst Turner weoe Ne eles ; i Administrator. aL To Dividend Iredell Telephone Stock 6.00 Hp Hai | To cash Hurst Turner 10/21/12 16.25 Ve | Sworn to and subscribed befor me. i lid To First Building and Loan Association ; 17th day of September 1921, ae| partly matured stock. 622.05 Hi J. A. Hartness evr ¥ To 2 shares stock Iredell Telephone Co. Clerk Gubatiae Cat” - 100.00 Note Statesville Flour Mi .1s Company 200.00 Audited, approved and ordered to be recorde One share stock C .de lan. Company. 109.00 is J.A. Hartness _ TOTAL CHARGES. 7069.30 CREDITED BY THE FOLLCWING GENERAL VOUCHERS: 4/8/12 Clerk Superior Court Letter of Administra. 5285 @ ASKS SBOIISOIOA MABA MAA LAB ZBBAIBAMLYA AY MALAY. 2. 3/31/12 T. C. Burgess account. 2.05 3. 4/16/12 Statesville Flour Mills, on account. 5.70 4. 4/6/12 Statesville Flour Mills, on account. 25.00 5e 3/16/12 Crawford-Bunch, Funeral expenses 73.50 6. 6/1/12 Landmark, notice to creditors. 2.50 7. 6/10/12 S. M. & H. Shoe Company, account. 290 a. TOTAL $113.50 unt carried forward, $113.50 8. 6/10/12 City of Statesville, tax 2.96 9. 6/10/12 J. I. Deaton, Sheriff, County tax 4.05 10, 5/18/12 D. L. White, account. 5.00 11. 4/14/13 Ramsey-Bo vles-Morrism, account. 1.50 12. ClerkCourt, Costs this settlement. 15. John A. Scott, attorney 10.00 — TOTAL GENERAL VOUCHERS. $139.13 Final Se i s ge r n ne n ar r a RR nn a rn on l Settlement of Roy 5S- Cc we Melchor note and interests. of personal proper Kennerly note " '" ‘cenner] y note still NMC pre pme VAL IIGNUU INL De Lipe, deceased, $600.07 109.86 105.00 16.00 21.00 845.92 87.42 87.42 87.41 emnaneenihioeemvens tt Mid, x $845.92 Cy 2 worn to and subs CHARGES. Balance on hands at dateof final settlement, Sept. llth 1920, See Book No 451.78 Interest thereon 18.07 Total charges CREDT Jstsus ss. Jn Voucher No. 1 J. A. Hartness, n > : £1 * - Le Palance for distribution. » 469.10 My intestate left him surviving his widow, Mrs. §S. A. Rhyne and seven children named below, who are his Only distri vutees and next kin, each eing entitled to 1.8.0f the above amount or “68.63. I have paid to each his or her part and list receipts below for said payments. Credit by following Special Vouchers, No.l Mreg A. Rhyne, Receipt in full for amount due on final settlement. 58.64 No.2. Mrs. R. V,. Nulls, Receipt in full of final settle- ment for amount due. No.3. Mrs. C. It. Rhyne, Receipt in full of final settle- ’ ment. Nowe4. Mr. T. M. Rhyne. Receipt in full of final settilem- ment. : . “ : settlement > 58.64 W. V. Rhyne, Receipt in full of firal se ° North Carolina i tlement. 58.64 ; J. 3. Rhyne, Receipt in full of final settlement — We s t s ? ~ sounty. ty > 1 ful ] t lement. 58, ) Tredell C 7 1 le, LO + +. i] ‘ Neceipt in full of final settlement. 58.635 In the matter of ae Lois Glenn, administratrix, FINAL SETTLEMENT. Va of Oscar Glann. ¢ »e My « h ° x a sworn de} 3 nd says: That the above an J. F. Rhyne being duly sworn deposes and say é ve se 5 me + ir +7 ne he r j j ‘ald nplete and cpyrrect supplemental final settlement of t foregoing is a full com te a Lee CHARGES. . . -“ ez rae f %. A. Rhyne, cGeceased, showing the amount on hands for final distri- estate of %. A. Rhyne, « ased, r fe "¥ To amount received from Sterling Mills for + t to whom same is to be distributed in full of the amount due injury to Oscar Glenn, ? 500.00 | bution ¢ parti ee oe a all to the best of his knowledge, on information and belief. Mills as Acent for Johnson-Nilier, undertakers, them, on funeral expenses, 100.90 To amou:it received from Sterling Millsas oh t A oe ttt Sas Agentfor CarpenterdNavis Hospital f Sent ber 1921, 55.00 TOTAL CHARGE 653.00 . 0°7 } Q ro ~ c rc \¢ - Awsa4 Pr) ia rovead this 14th day of september 1921. Bxamined, Audited and apnroved, this l y I CREDI ’ BY FOLLOWING VOUCHERS. z A. Hartnes 1. Clerk Court Letter of Administration. $ 8.25 a : 2. Johnson & filler, funeral expenses 109.00 x QO D 5. Carpenter-Davis Hospital, Medica} i i 53.00 4. John A. Scott, attorney 250.00 5. Costs this settlement. 075 Tote Nha in ae ee ee fotal Charges 5407.00 Ballance due the estate $246.00 Credit by special vouchers as follows: Lois Glenn 123.00 By her receipt October 6, 1981, 3123.00 Virginia Glenn 25.00 Byreceint of J. A. Hartness, C. S. C. 98.00 By her for necessary support of said 4 o minor, 25.00 Sworn to and subscribed to before ——____ Lois Gienn, me this 6th day of Oct. 1921. J. A, Hartness Cc. S. C, (4 Arve JF G00 4 miner Did iedp tun? Aud prored ty) Roky Ti. RA, Jobarton— In the Superior Court. North Carolina, t Before the Clerk. Iredell County. In the matter of Virg'nia Glenn, PETITION. indgent minor. Lois Glenn, mother of Virginia Glenn, a minor of the age of three years respectfully shows to the Court: lst That the petitioner is the mother of Virginia Glenn and that ‘ my > said Virgnina Glenn is a minor of three years of age. That the petitioner is a wicow and is absolutely insolvent anc ownes no property that the minor herein above named lives with her and is supported by her and that she, the 1.4 , u J said Lois Glenn earns a support for herself and her child by her own work ‘ A hed o 2s ‘ 7) as @ servant. end. That there is now in the hands of the Clerk of the Superior Court of Iredell County the sum of “123.00 belonging to the said minor, Vir- ginia Glenn. That the petitioner has already spent out of her own earnings a considerable amount aggregation }25.00 or more for the support of said child. Wherefore the petitioner prays the court that it will reimburse her to the extent of $25.00 for the money so expended by her, and further that : ‘ > ) he the ba ance of saidestate, being less than $100.00 be turned over to her t 3 7 mother of said child for its necessary supnort and maintenance as provided by law. In this connection the petitioner says that A. B. Johnston, who is a responsible solvent white men, has agreed to execute to her a note for 1 : . i a” a the principal of said sum bearing interest at 6% .« Lois Gleen, Lois Glenn, »eing duly sworn, aeposes ana says, that the facts set forth in the foregoing petition arc trae of her own knowled e except as to the matters and things therein stated upon information and belief and as to those she believes it to be true. Lois Glenn. __J. A. Hartness, Upon foregoing petition it is ordered, that twenty five dollars be paid over to Lois Glenn the mother of Virginia Glenn inidgent minor. It is fur- thered ordered that the balance due her to-wit *98.00 be turned over to A. B- Johnson to be held subject to her use, J. A. Hartness, Oct. 6th, 1921. Clerk Superior Court. JIB BOGE GIGI IBOBIOBIATSIOVSND OG) GOdIE3000 eUa98R000 To J. A. Hartness, Clerk of the Superior Court. The following is an inventory of the personal property e longing to the estate of R- W. MeKey, deceased, late of Iredell County, hands of his auxecutor, One note on J. FE. McKey, dated May 10th 1916, due 12 months after date. 75.00 One note on J. RF. McKey, dated March 5th 1920 due one day after date. 844.26 One note on Mrs. Nannie Cathey dated April 27th, 1915, due one day after date, 25.00 One note on J. J. and W. p. Rogers, dated Sept. 1921, due 12 months after date. 328.00 Accounts due by the following named heirs ‘t law for which they are required to render an account as advancements. Mrs. R. H. Roney. 100.00 Ten U. S. War Savins Certificates Stamps, apr. va'ue,1923 50.00 Certificate No. 38. 499 for 10 shares, second preferred stock of Hunter Manufacturing & Commission Co., Greensboro, N. ¢. par value $100.00 per share, Certificate No. 8. 346 for 20 shares, par va ue of $100.00 per share, same Company & C, Certificate No. 17 for 10 Shares capital stock of the Dixie Cotton ills, Mooresville of the par value of 5100.00, each, Certificate No. 237 for 10 shares of capital stock of the Dixie Cotton Mills, Mooresvi'le of the par value of $100.0) each. Certificate No. 441 for 5 shares preferred stock of the Moores- ville Cotton Mills, Mooresville, N. C. of the par value of $100.00. Certificate No. 12 for 20 shares preferred stock of the Rhodehiss Mills Co. of the par value of $100.00 each. Cash on deposit, Merchants & Farmers 3an, # 149.76 Emoney L. Wilson, Executor of R. W. McKey, deceased, Subscribed and sworn to before me this Sth day of September 1921. ———!. MeKnight. N. P, 908.538300003080 1020800008 Which came into the ee ee aT fi. Sughd . Sp) North Carolina, INVENTORY OF R. Le. DISHMAN ESTATE. C we e ma Je Two mules. In the matter of Jean Caldwell, administratrix, One pony. Tyree Milk cows. os Bs FINAL SETTLEMENT. Lee of Lily Caldwell,deccased. it ts Four steers. CH: ARGES. Four hogs. September 12, to cash on depos One farm waron & harness. . )ne 1 > n) on Union h ational Ba I K , Cha riot »e 218 40 Vile LOE wag ile J aw |{ i] } n rine hal si int rest September 14, to cash Bank 0 ~aw Mm ec eng + — e * ° Commerce, Norfolk, Two log carts. Le.10 S IT 2 ‘ neen > One thresher & bailer, half interest. September 14, Bank of Comuerce One Fordetraetor plow and harrow. Norfolk, Saving account, 463.95 aA One disc harrow. » 694.45 One wheat crill. CHARGES. One Do@ge touring car. ' i le de A, Hartness, letter of administration. 5 63.85 One Ford roadster. i) ( 2. Statesville Realty and Investment Co. Bond, 10.00 aP One buggy (pony). at Se: City of Statesvilie, cemetery lot. 40.00 eit tia F wie ia ; oe i Oct. let, 1921. Mrs, R. L. Dishman,. 4. V. H. Smith, Norfolk, Undertaker, 219.00 an) Administratrix. 1 / ‘ } tn 2G, DAstQnwrare—]) 5+ Young Woman's Christian Home Norfolk Bond, i (aw F 46; : , ie 6. J. A. Hartn SS, costs t is settlement. 5.05 Se IB G28 XQ 7. John A. Scott, Atty. 20.00 Q@Q0GQ@Q Qu 3 AD ADI 3G AZ 8. My Commission, 50.90 3354.80 TOTA iL, C HAR GES Je Balance due Est. te. S 339.60 CREDIT BY GENERAL .OUCHERS. Miss Jean Caldwell, sister, 559.460 By her receipt. Jean Caldwel} Admini tratrix of Lily Caldwek1, Sworn to and subscribed before me, this October 10, 1921. J.W. Sharpe, Dep. C. &. C. QBGHBEs ~ _0V33GVIO.IVGBOO@BI9 QQ28..2 BGGBIBZR: 8BIACIAGIWIAIWIAV9E2e ee J. S. Bebber Fyour ( 56 lbs.) .07 $ 3.92 ipormm IT SC) RY N THE ES ES 4 pp ls INVENTORY OF THE PERSONAL PROPERTY BELONGING TO THE ESTAT OF JOHN ; P. H. Lazenby Fl ur ) 55 lbs .) 073 3.99 it LIPE,STOKES LIPE, AND LIPE, RENDERED THIS THE 3rd, DAY OF OCT. 1923, David Revis 1 ines (25 t : 4y ” an " " " 51 fi Each of the above estates are invested in funds paid into court by i i = ater Lee Paris Meal sifter 205 h } ; a ; sh s in the final . 4 | ee. Se ey re ee Mrs. J. A. An erson l bucket, 2 pans 46 pee Hi ttlement of the above estates Total amt. due are the above esta‘e is ee ee at ee t,o . Mee i se 2 IN€ i aan . ome f if : David Revis 5 9S mee S. - : I 4 about %189.00 There is no other property belonging to said estate. a scraps meat(9 lbs ) 10 90 ih - “ea W. A. Bristol Wash pan .05 af : ge s44 Eee r e Bi " " tt 9 i 4s acuee 1 meat ham ( 21 lbs. 3/4) 7.35 | By Will Hoover en ie Meat ham (21 lbs.) .35 7.62 : 7 J y Pe S Me e | " . ’ 1 shoulder ( 123 lbs.).25 3.00 ‘ Will Hoover being duly sworn says the foregoing is a true and correct Mr. Bebber Meat (20 lbs.) .27 5.40 inventory of the above estate. This Oct. Srd, 1921. 4. A. Bristol Meat (21-3/4 lbs.).26 6.65 ait vs T7 ' if dil) Hoover. 7 . Wheat, 8 bu. 32.75 22.00 ih Sworn to and subscribed before me this the Mr. J. S. Sebber 1 lamp 025 ie H i ord day of Oct. 1921. Mrs. D. Hayes, 1 lamp 030 Sy | J.W. Sharpe, Dept. C. S. C. Mr. Hens>aw 1 dish 005 Bob Hayes 2 table covers 25 H. ©. Hunter Preserves 2320 Q@B.-0C3GA4LIIOVE@EQWQESW.IVB T. M. Stikeleather : 025 FQ82 CICA ADVABWIVSBWB Mrs. J. A. Anderson 1 pitcher ©3530 Miss Pearl Powell 3 little dishes 05 David Revis Glasses and powders H. C. Hunter B. P. and jeary. 05 North Carolina, ) irs. V. Hayes Little dishes 06 Iredell County. ) is Bunch of little dishes P. H. Lazenby 2 Old dishes «LO Harmony Banking & Trust Co., Adm'r, a@zenby ; 5 r Sate ord . W.W. H Pickle bo'title of Preserves -05 of the estate of Laura “ayes and Bettie ) FINAL ACCOUNT. 111 ) De ( is Jar and molasses 05 Hayes, deceased, ) vavid Revis ca Mr. Hens).aw Dish and pop corn 005 To the Hon. J. A. Hartness, C. S. C.: P. H. Lazenby | Jelly 05 The undersigned Administrator of the Estates of Laura Hayes and Bettie J. A. Anderson . 415 Hayes, deceased, respectfully beturns and shows upon oath the following as Mrs. Pig Patterson 7 015 a full, just, true, and perfect final account for settlement of its trans- 7 . | . 017 actions as such Administrator: Miss Nannie Powell Jar of jam. «40 RECEIPTS. H. C. Hunter Jam °40 Sale of Personal Property on June 4th, 1920, i. ee Jelly and jam, 045 Bob Hayes Corn Popper 4 15 David “evis _ Pepper box , etc. eO1 Arthur Kinder 1 axe 1.90 Daivd Revis Jar and preserves 05 P. H. Lazenby Flour (27 lbs.).06 1.62 ' ® ast OL1, etc. > 205 David Revis Castor - Lee Paris Preserves 17 hy € 2S 30 Mrs. Pig Patterson Jelly, 2 glasses m 21 J. A. Anderson Peaches os : : 4 jars peaches at .18 042 7 ' 4 jars peaches at .21 84 " . 6 jars berries at .16 96 P. H. Lazenby 2 tomatoes at .17 034 Navid Revis Peaches 035 Mrs. Pig Patterson 7 jars peaches at .1l eet H. C. Hunter 1 jar peaches 246 NW. A. Bristol Peaches se Will York Cho chow 050 H. C. Hunter Peaches and apples 220 David Revis Jar peaches 205 irs. Pig Pat erson 1 dish 510 Ph We AYE) Knives and forks 052 Mrs. Pig Patterson Sugar dish 56 Pe 8. Hy Cups and saucers oid Miss Nannie Powell Pitcher and dish «10 r n David Revis Dishes eO1 Mr. Henshaw Basket Plots) David Revis yliing board, etc. ~10 r. Hensaw 4 jars, etc. o26 Me. Jim Tolmin 1 hammer 5 Vr. Donaid Moorefield2 jars. Mrs. Bud Hayes Bucket etc. 458 Mr. #. A. Bristol dinner pot 1.00 v5 » " " irs. Bud Hayes Mrs. Pig Patterson 1 tea pot 41 Mrs. Pig Patterson Dinner pot 1.00 ® ” Pot hooks 230 Mrs. Bud Hayes Skillet and lead, 4218 Mrs. Pig Patterson L tea pot Lee Paris Tea pot 165 l'rs. Bob Gaither Frying pan e70 Mrs. Bud Hayes Dish pan 56 75 06 Mattie May Powell Big boiler ~o Mrs. V. Hayes Leads Mrs. Bud Hayes, Frying pan. Arthur Cranfield Bread pans W. A. Bristol Dipper , etc, Arthur Cranfield Pans 4%. A. Bristol Pans D nald Mooreficld 1 pan J. A. Anderson Bread pan Mr. RBebber Coffee pan Mr. J. S. Seb er Stove J. ¥. Tomlin Oven and skillet %. L. Hayes : . : Mrs. Donald Moore ield fash pot W. A. Bristol 1 cow Mr. V. Hayes 10 bu. corn at 52,26 Mr. 3,b Gaither 10 bu. corn -t 32,21 wT ” " Remainder corn at $2 Miss Pearl Powell fash tub Arthur Crandfield . : Miss Tishie Harp lL cow chain W. H. Padgett Cow chain Clong Campbell Sails Rev. Wall Cotton Seed Miss Nannie Powell Yalnuts Mr. Harbin 1 basket David Revis Churn Mr, HW. York 1 clock Mrs. John Hayes l rocker Lula Steele 4 chairs, 60 each Mrs. Henshaw Window curtains. Mrs. P. Patterson lL cupboard J. L. Sherrili 12 gars at .06 re W. L. Davis 9 jars at :.07 Mrs. P. H. La enby 11 pt. jar at .04 Mrs. P. Patterson 5 pans , dipper Mrs. Darwin Hayes 2 pans Miss Nannie Powell 3 oans Mrs. Bud Hayes Pans J. A. Anderson . Mrs. V. Hayes 2 stone jars, Mrs. Bud Hayes 1 stone ‘ar, Mrs, " o 1 stone jar. J. A. Anderson tw o stone jars. 1.40 . on en Oo on 1.90 1.25 2440 44 +20 021 15 025 17 -18 «10 025 amma m ———— cs eae Re EERE TEEN ennnerenee Mrs. V. Hayes Rev. Wall Bob Hayes Darvin Hayes Mrs. Patterson Mrs. Anderson David Revis Mrs. Tisnie Bob Gaither Mrs. Tishie Harpe Bob Gaither ns rs. Crandfiled York Lazenby " Vr. Henshaw D. Moorefield We Hill Miss Pearl Powell " " 1 nshaw Revis Bristol Bristol Hayes Revis EH. Lazenby #4. A. Bristol RR. D. Revis S. N. Haves Butter print. Spoons Dishes. Di sh + oli Pepper box, etc. Dutch celaer , etc. Forks, knives Butcher knife 3 dishes Tea pot ishes C fre Powders and rice of sugar 60S each -O5 each 2 rolls sausage knitting needles Tea pot dish 1 jar preserves l ‘ar preserves, Cherry preserves Strawberry " brooms broons brooms brooius brooms broons brooms brooms brooms W. A. Bristol J. T. .Tharpe Mrs J- A. Anderson WW. A. Bristol J. S. Beeber S. Bebber A. Bristol 4. Bristol HM. Stikcleather Paris A. Bristol La enby Rev. Hall Mr. Stikelcather Lee Paris Mrs. Beb>er Arthur Canfield , Mrs. Blackwelder lirs. “ud Hayes Mes. Bud Hayes Mrs. Bud Hayes Mr. Harbin Hall Patterson ie Harp Ezra Hayes Hunter Hunter o73 lbs lbs. 8 lbs.s.j. 14 lbs. “ollases 5 gal. can 5 ga. 160 3 buckets, 1 sack pop sack nop Soap " Meat “ar, “ar. inerar Or inega *, o Jars ind ji p 235 Bucket : » 40 inegar 40 Goard 1.25 Fodder per hun , 6.93 164 lbs. fod’er Shucks 5 bales straw loose straw Axe n Shingles 59.00 7.63 Total of June 4th, 1920. sale 470.77 eee ? SALE OF PERSONAL PROPERTY JUNE 30th 1920, Maude Powell Hayes Patterson Sale Bakset Work basket, pit. " " Mrs. Patterson Starch Bristol Basket jie the A. ?ristol Beans115 per Stikéleather Bed Patterson Elmore Map >of U. Carpet by bunch L trunk “wash board Spinning Wheel boards tub Table (walnut) dalnuts chairs (.40 e. chairs. Arthur Cranfield Patterson Patterson Lula Steele Mr. A. Myers ettic evil J - Albca Albea >. Chambers Quilt H. C. Myers Blanket Mre,. Anderson Comfort Made Powell Quilt Mrs. Patterson Couterpans te A Bristol . Patterson Mr. Henshaw O. H. Lazenby Mrs. Patterson C. Myers H. C. Myers Dr. Jurney Myers Lazenby Myers Lazenby Henshaw Jurney Henshaw. Jurney H. Lazenby T H. Lazenby Mr. Henshaw Maude Powell Darvin Hayes Mr. Stikeleather Mr. Henshaw Mr. Stikeleather Mr, Myers Mrs. Anderson ‘rs, Anderson Mr. Stikeleather Dr. Jurney H. C. Myers Darvin Myers John Tharpe. Ge By Hayes Arthur Kinder ‘rs. Bud Hayes 'rs. HW. Powell Mrs. H, Powell Counterpaine Straw tick Quilt whe t " Blanket Quilt Tick Blanket Sheet juilt Blanket ~nect. " Cotton 8 lbs. .21 per lb, 4 lbs. 15 per lb, 5 lbs. 107 per lb, Quilt Bed tick Sheet 330 1.236 80 ede sr —o m e n n a r in a t e Re ek e an Bo e 2. eS H. C. Myers, Dr. Jurney irs. H. Powell Maude Powell Mrs. H. Powell Darvin Haves Dar in Hayes " John Thomas P. H. Lazenby Patterson Darvin Hayes Dr. Jurney P. H. Lazenby Dr. Jurney Bristol Mrs. Ande so Dr. Jurney Mrs. Anderson JOhn Thomas Mrs. Anderson \. Stewart Dale Jimmie Hayes Lula Ste le Lula Ste le Maude Powell Mr. Sherrill Lula Ste le Bob Hayes Mr. Sherrill Mrs. H. Powell Mrs. Revi: Arthur Crandfield o Mrs. S. Hayes Arthur Crandfield a s. S. Hayes Counterpaine " Guilt Blanket Guilt spread " spread " Towell goods Ging am 7 yds. Domestic 3 yds. 31 per yd. Sheeting 7 3/4 yds, 283 per yd. Cloth 9% yds .14 yds Outing “gs yds .32 per yds Cloth 13 yds .15 per yd. Sheeting 10 yds, .28 per yd. Ginghams 123 uds. , 5 yds. .27 per yd. C,oth 4 yds. .16 per yd. . 5 yds. .27 per yd. Window curtains. Sewing machine Glas Window Glass Mrs. S. Hayes, Arthur Crandfield Mrs. Anderson Mrs. H. Powell P. H. Lazenby Mrs. C. Chambers Mrs. C. Hayes Mrs. C. Hayes Darvin Hayes 3ud Hayes Mrs. C. Chambers ? Mrs. Patterson !". L. Harpe LY - oo - ~ fle Lazenby ve ik N. Haves y Powell H. Powell S. H. C. Gaither A. Bristol H. C. I'yers o. Hayes Powell adgett RECEIPTS FROM THIRD J. W. Aybea Will Hayes Howard l'orefield Chas. Hayes Clong Campbell Glass Trunk c we 4 ° 2ewing machine Trunk Chest Quilt squares bl oO cks " lining blocks. Dresser dgsh dish Slate Picture & v 05 249.64 SALE. 135 brick 3ed Boxes Pulley Gourds, plows etc. Corn 25 bu.$1.00 per bu. Dr. Nétcholson 1. Hayes Corn, remainder Arthur Binder Lazenby ™2,00 t Haves Hayes J 7 Fodder per bundle 240 bundles Mr. Plackburn Rev. Wall at, £6 or 17 bu. Gaither Mrs. Powell Irs. Powell Mrs. Haves W#. A. Bristol Arthur Kinder Ps He Boistoi P. KH. Lazenby nN N. Hayes Mrs. Powell Corn 20 bu. $1.03 per bu. Mr Stroud. Trish potatoes $1.35 per bu. Onions by the bunch, .05 Barrel 9 Tops per hundred %2.71 205 bundles 70 1Y- nayes per bale °%1.01 7 bales otraw ’ Straw, per bale °1.00 7 bales Straw Boards, per hundred, .21, 350 Gcrap lumber, 2 piles P. Il. Lazenby 4 gal. molasses Bucket, rope Head rwrap 2ig scarf ibrella " Bonnet " 1 corset tullt squares, Towells, per bunch " Bristol Bristol Lazenby Lazenby Lazenby Lazenby Lazenby Hayes Nicholson Lazenby Lazenby Lazenby "rs. Powell P. H. Lazenby Mr, Sherrill WY. A. Bristol ¥. Aw Bristol Mrs. Powell Bristol Powell Howard Morefield Jimmy Hayes C. N. Hayes Fey Lazenby "rs. Powell W. H. Padgett E. Hayes Table cloth and nanpkings Pillow slips #2 plil Chairs Bunch " ows of books " T tal from sales of personal property Received from J. Hayes, brother of dec certificates of deposit.and interest on War Saving stamps To al deposits. Ol 5.00 5.65 8.85 15.00 2.00 47 ec 205 005 Y 908.03 cash and tificates. 685.97 17.64 (Grose Bros,)4.09 y 707.70 aii ceaiagen NiTTCS DISBURSHI TNT Je 1926, paid J. A. Hartness, letters wh Ap Fe ' July 13th, 1920, Paid Genevieve Lazenby, Clerk June 7th, 1920, Paid C. A. Grose, & Bros. June 10th, 1920, Pai W. Baity. June 30th, 1920 Gaither. Auge 1921, Cruse Sept. 18th, 1929. pai i. GC. Henshaw 1920, paid J. M. Hayes 1920, paid J.T. Tharpe * , 4 Grose Bros. o i) of ept. 27th, 1920, Connor, isbursements. commissions on receints. Adm'r commissions on disbursemen Se T tal disbursements. Total receipts brought forward, admr. 7270 5.00 150.00 1.50 11.59 10.00 3240 50.00 190.00 2.00 73.50 100.00 9.05 4 — 2.9.2 99 1567.29 80.7865 28.5645 a ) 676.4410 nD Ba. on hand for d stribution among distributees. Paid out of aboye balance to distri butées And Bettie Hayes, de eased, ing & Trust Co., To Sylvester Hayes 1/7 interest T. Chas. ll. Hayes 1/7 interest. To M. Hayes 1/7 To. “pc. H. C. Gaither, 1/7 interest Letitia Harp, 1/7 interest Mrs. Emma Powell, 1/7 interest a rs. Mary Powell, 1/7 interest of Laura aA y by check, on “ammony Bank- dated Sept. 29th, 1921 as follows: 134.18 1354.18 154.18 134.18 154.18 154.18 154.18 939.26 a ” 939.29 Sworn to »efore 8th day of Oct. 1921 J. Wi. Sharpe, Dept. Clerk Super: The foregoing minstrator of the estates vouchers supporting the mé, is hereby anporved and of Laura and Bettie Naves mé, having been carefully exami: Harmony Banking & Adninistrator. B i wide KR. Harkey, Cashier, or Court. final account of Harmony Banking & Trust Co., ad . >, accompanied by his ned and auditedby ordered to be recorded and filed, This the 8th day of Oct. 1921, We, the undersi distributees of the Estates and Bettie “ayes, deceased, awa. : 3 : Of 3134.18, paid to each of of the “states of Laura ‘lay in full payment of all suns said Laura Haves ‘J Thi his the We, the undersigned Mrs, Bouma Powell, Gaither, distribu deceased, and each of us, he to each of us by the Harmony Laura Hayes and Bettie Haves o all sums due us is distributees of said and Bettie Hayes, deceased, oa % ee 1 and said Bettie “ayes, J T a - A. Hartness, Clerk Superior Court of Iredell Co, €ned Sylvester Hayes of Laura ayes and each of 98 . 4 aS. N. Hayes, J. M. Hays us, hereby acknowled e the receipt 10 4+} i " ? a 7 A ' us by the Harmony Banking & "ruct Co., Adm r es and bettie Hayes, de ceased, the same bein due us as distributees of said Estates of the 2. ‘ 9 aeceased, of Sept 1921 vey . ee, Haves, Haves, haves, ‘'S. Letitia Harp, and tees of the Estates of Laura and Bettie Mayes reby acknowledge the receipt of $134.18, na id Banking & Trust Co., Adm'r of the Estatos of », deceased, the same being in full payment of of the said Laura Hayes This the 29th day of oepte, of $134,18, paid to me I, the undersigned Mrs, “ary Powell, distributee pf the estate of we Leura Hayes and PO Lt AgrEey Oftaa GoRoe8 Od hereby oamagas cee the receipt a A y the Hamhony Banking & Tr Mrs. Emma Powel) __Latitia M. Harp, Mra, H. Cc, Gaither, Co., Adm'r., of the estates of Laura and Bettie Hayes, deceased, the same being in full payment of all sums due me as “ayes and Bettie Hayes, deceas ., is the 14th day of Oct., Subscribed and sworn to before this 14th day of Cot., 1921, aOtry LL. Bard, Notary Public distributee of said estate of said Laura ed, 1921, M me, Mary Powell, North Carolina, TIrede!1 County. In the matter of B. L. Biggers administrator of ae ae ee ee Se e B. D. Graham, deceased. i i i it J et To Honora>le J. A+ Hartness,. Clerk We | : dell County, N. C. ne i } The undersigned administrator ie 1 a NW. @: “ene 5 Sle witt i ; Iredell County, N. GC. “egs leave to file with i ; the estate of said deceased, as follows, to-wit: | A : Tirst N ional B kK States 11 Ne % i August 10, 1921, First National Bank, Statesville, i" ioney on deposit subject to check. August 20th, Certificate of Deposit, IF. d. 1921 Returned Fire insurance nA _ me GOTAL RECEIPTS. Buildin’ & Loan shares vet in hand. nT tr T an YS In the Superior Court. Before the Clerk. of the Superior Court of Ire- of B. >. Graham, deceased, late of > you herewith his inventory, of alary check from Brown-Rogers. premium RB a LL. Biprers se $207.34 204.90 3. Statesville, . ‘400.00 5e13 $815.37 167.50 o Subscribed and sworn to befor BOG BOCLGIA North Carolina, ee Iredell County. In the matter of lirs, M- <A. ~omers, ) Administrator of R. V. Somers, deceased.) T Oo J Received from Bank of Stony Point Received from Amsey Millsaps on note, e€ Dept. C me Adninistrator of de this the “ue Sha Bs Gs ( dee Caah hook #3 ?/+4) MMBPDRAAANS . A. Hartness, Clerk of the RECEIPT c we Received from Bank of Stony Point interest. CA AD ARAAAMNS ABAADAD A Ad In FINAL A rpe the < uy wiud » 65.00 D. Graham, 15th day of deceased. October, uneri ar Cr urt. TLEMENT. Superior Court: 536.40 155.00 Audited and approved Oct. 15th, 1921. sees eeensheepemeenens Received from Marvin Watts on note $155.00 T S iis ; Foal Receipts. $912.00 ; DISBURSEMENTS. tee LQ as A. Hartness ( c Cc T?- re ae =e is sc POR Le tter of admr,. Se ie 28th. § 3.285 i TO 60. Mi. po e ie PE a ei s 4 ller burial expenees Sept. 28th, 53.00 PE x ci t e a ak a m r ‘ Oo. OP, Te Di: Cretieoh for De. BEI1 tac T é ch for Dr. Bi ar 2 vu I on200 sa ‘ : ; lo the Landmark for adv. for Creditors March ist R aes af . oe ; To Barron and Connor for Onunent Sent. 23ra To Dr. E. M. Yount for Dr, 8121 ™ ‘ jar+ne . : ] To J. A. Hartness, C. S. C. Sept. 29th. 75 1921 , To Lewis & Lewis Attorneys October 15th. §.00 § Te li M A eee ae « cy . t i sO “PS. MN. Ae Somers adur. 5” on “912.00 receipts, ee 4 & 7 ae and 5% on $240.00 disbusements, 57.60 4 nn ae nee ee eneneennneme + a Total disbursements. ' a $303.45 a , \ * on RY e Balance in hands of dministratrix for distribution among the following heirs at law; of R. V. Somers , lanan ean & V » deceased, ¥608.55 Mrs. M. A. Somers widox "86.93 Credited by her voucher Mra Trmrnoe + TY 1 Q 2 irs Lé Dourlace +29 i I « PMCS YOU LA<§& O0e70 Credited by her voucher rs. L. KE. Hoover 86.93 Credited by her voucher. 86.93 — Wie : ; ary Somers, minor i 86.93 € Nthernredcl a An G, dowry, : Dewey Somers, minor 86.93 ( n " J Sag G Om ; o r ry ty Glenn So: iers, minor 86.93 ( ut " " Cara Comers. 86.93 ( ut n M. A. Somers Sworn to and subscribed Adm' tri; > Oct. 15, 1921. ok iia Hartness, 325 | Before the Clerk. In the Superior Court, Final Settlement of Claud Lee Lowrance Executor of DP ce, Exe ofp - L. Lowrance, deceased Tredell County. Receipts. NONE. It annearing to tie Court toat the above minor children Mary Comers, ss | DISBURSEMENTS. ; A ae Dewey Somers, Glenn Somers and Cara Somers are each due the sum of 786.93 in the 192 fi + Vv PW ° 7 fs q ae ; ‘ cs +r 5@ ment and at the said children ahd ae tha 3 nist ratrix upon final settlement and that t C re ' hands of the admini I po Oct. 8. W. W. Rankin, acct. $5.50 and needy and that no one will become guardian for them and it © » jndiren are indigent Nov. 5. Miller Drug CO.» appearing to the Court that it is for the best interest of said children that . fs Sept. 20s BH. N, Johnston Co 21.00 said sum be paid to the mothers for the maintainance of said children: Lt 2 - said sum be pai Miller Drug Co, 2.413 is therefore ordered that the sum due each of the aforesaid minor children be ‘ s e = bers 22 8B. M. McNecly Co. funeral 88.85 4 : : f Cama ¥ nie gai i ) ar to expenses iti o Mrs. \'. A. Somers, mother if said children to be used by her t ‘ xpenses, paid to Mr ’ O Mooresville Drug Co. acct. 1.00 0 maintain and educate said minor orphans. " : 15 Dr. W. E. Wilson, acct. 8.00 as A. Hartness " iu ae os Clerk Superior Court. 25 te M. Lowrance acct, 7.0 cy . | RE 29 W.M. Mechols i “a pe Oct. 15, 1921. hols 13.85 bi "25 Mooresville Enterprise 2.50 " ° ™ m 7 Sb G 20 Dr. G. q. ayior 14.990 i @C@@Q2GOGQR BB 0L@E Oct. 15. Doc. James Lowrance legacy 50.90 fi | 3 J "” " " " | for {i Francis Longe Lowrance 00.0 i vrancis Long Lowrance 100.90 | i OCG... 18:32. » Hartnesas, C. 5. C. 1.80 Bh oy it " ’ + ee . line i ny i: “4- V. furlington, atty fee 10.900 H i ‘Saeca 20000 POO4 OL / ' 2 Tawn- ry hair op y lanncacr ¢ ) + Claud Lee Lowranc: being sworn deposes and says that the foregoing settle mént is true and rrect to the bes f his k 17 , inf me) ue and correct to the est of h now lecge, information and bee cs m™.. gt a ae gee a . Li Of, That he has paid off all claims arainst the estate of D. i Lowrarg ¢ Ww wee ‘ - a - ave /* wal ¥ A; ; oO ¢ <a oe e ae , - % . oo Gceceasedc that have ben presented and has paid off all lepacie mentioned i 4 LO U5 Ul l1e¢ in the said will. Sworn to and subscribed Before me this the 15th dav of October, 1921. Personal Property The above inventory 2, S ry t nd rh f e TY > awe 7. Sharpe, Dept. Sale list D. C INVENTORY 7 note VB WF. H. F. 1 note VS J. D. Beaver Vc ! Ras 7 1 note VS M. Ae eaver information and belief Foxworbh ,ler ESTATS OF J. J. BEAVER 5 DECEASED. %500.00 2909490 7 2886.00 true and Aug. Le 1621.4 Administrator onetty. June 8th, 1 wagon 10.00 l niow tock 250 L cultivator e 76 June 8, 1921 ‘ 10 bu corncs7¢ 8. Corn 50 bu.Q90¢ 45. J.-A. Chandler _ Administrator, M. A. Beaver _ Oe .ccurate to the »est 70 00 of my knowledge Vestern Union Telegraph Co, de he final settlement. North Carolina, ) In the Superior Court. Iredell County. ) Before t] In re? John D. Hartness, Administrator ) of the estate of N. F. Hartness, eceased,) my, Try . , » TO J. A. NARTNESS (CLERK 0 MANS sULEKK OF SUPERIOR cour? John D,. HNarhness, Administrator of N. FP WW n" T ep ps ‘Veal solu 1e Clerk, TYLEMENT. - I'. Hartness, deceased, submits the following as his final settlement of said Oc’ TIM eee dabwre Cach on hand at date of death of deceased, Received from sale of wheat Received from sale of rye. Received from sale of personal property. Collected cash from A. B. Elliott note T. H. Sloan, note, princ ipal and interest M. A. Robertson note, principal and interest 4%. J. Page note, principal and interest Collected on Mac Warren note and bond for title Collected from Lucy Adams in Jarren note and bond for title, Cash received from R. Be MecLa ghlin, Att'y Collected from Statesvilte Realty & I «x investment Co, in final settlement. MAM AT AVd Aid DISBURSEMENTS. A. vy 5 J. A. Hartness, costs vo «BB D. ”. McLelland, J. P. allotting years support. " " " Neil Johnson D m ive Le Weatherman, attorney fee in settl- ing estate, J. M. Deaton taxes. 29.96 J. .. Hartness costs 75 ¥. C. Johnson, hauling monument. £050 Levi Lambert 1.50 Statesville Marble & Granite Works, monument, T. G. B, Davidson, auctioneer. John D. Hartness, Administrator, no % Commissions on dbllectionaic. 103.57 Nartness, C. S. C., auditing 7252 ) “ settlement of balance of Mac —= ha estate: 230.00 51.25 13.50 17.83 190.00 480.33 29.56 £219.00 135.70 500.00 119.23 176.00 071.40 John D. Hartness, Administrator, 5% A commissions on disbursements. » 10.30 TOTAL $322.21 Balance for distribution among the $1749.19 Distributed as follows. To W. in compromise of final settlement %196.43 his share. so Hartness in final compromise settlement of 246.43 for equal bution. Distributed as follows: L. J. Hartness, widow, $261.26 N. Hartness 261.26 Vance Gwaltney 261.2 Carric Godfre 261.27 or D. Hartness 261.27 *1749.19 J. D. Hartness Administrator. Sworn @nd ‘subscribed before this the T} 1e foregoing final settlement of John D. Hartness, Administrator of Hartness, sccased, is this day audited, and the same is hereby in all approved and ordered recorded, lis the 24th day of Oct. > “7 , > WNARNRKRAAAAS MAMAS North Carolina, Tredell County. in Re F. fF. Chambers, adm?lr of the ) Estate of Annie Long, deceased, ) FINAL Mm - ha ] f Te ry fo the Hon. J. A. Hartnes » Clerk Superior Court Chambers, Administrato: of the Estate returns and Shows, upon oath, the fol and perfect Final Account for settlement of his Piet ie : . istrator,. The undersirned sale all ures on wall broken vase 1 8- day rant nib 7 Winadow Goblet, 1 tumbler lace wurtains cane bottom chairs napkin One rocker SETTLEMENT. -- GREETING: ot Annie Long, ceceased, re lowing as a full just, true © transactions as such Admin- ro ‘i . a v O ~ ea l oe v S « i GQ , \ 4 - ' ~~ { ” © y Hs . ‘ by c * r rc . er co ‘ ; . Ba c ” a. C a . . ~ C4 g - 2 ¢ ss % C r “7 © xs gy un - . 4 : s & ai e € : $ ra ~ © — . == . ~ + + o ‘ > = c ; = \ os - r- ‘ - o ! C + ) . : a a uo £, ; . ~ mR , C - ' i , ° S 4 rm e we _ or t € - rc + . ” ° t3 rt r © - ¢, “ ~ . ul : rl r . + - i) _ w x d a ¢ ¢ % e - . c 2, a“ ; : : W {. +» = 5 = ov . c ' or t ‘ ‘ eS ms G - ° U u ' c a bY a ° oS Oo % - ‘ c “ - ~ re Co c 0 os Sy } . [= = at be = : ; ‘ s f ) " : < C ; : - « © © C, ® ~~ ) c ¢ a pa a t + - oO a co a t o o c ‘ ek Q > a . : : ; P ' e c ¢ ~ > a or . ; © ° . ~~ . + ¢ G = ~~ a ~~ c > of “ a Ba Ww © O° “ c — ne . : r = — S wa Cc C 3 2 . © s ¢ ib ] on l ¢€ an or t ¢ = _ é & ”~ ct a ne : - ~ . ” © » © ~ ” ° o - - - v $ BA re G Q © _ ot 9) Qn -~ Y in si — ~ * © S, ( > ~ 1) 5 . = % x n © el a) ® ® Y cy ‘a . ; ‘ ~ > @ ~ = oc CO i. 5 “a fa as ~ } cl + c r P > 5 5 2 . } ad 4 + S C x ~ + + Cc ry Yr co . - — G > € oO C = , ® @e ri tt « = 3 oS co op + or l = t C e . - . o, « a c : » = 2 ‘ 2 > % Le e Q + Be S ® f rt q c S. ~ a ® co m2 " c < = = cs + - D ® ° ? es c gy 6 ! C © U 7 S 2 » + ~ r ' ra ct ce cu a r r Ge 1 rle harre § ot fun. Love , +7 4 re (16.3 ! t, 4 forks, f : 1 tohey ley 16. ( > 4 4 i . ; 2 = en Lone ” . eee ee ee eintheas: rina ‘ ) ) ( pA} ‘ , ( ) . } + 1 , , 1 + y ) t Wn . ? “ ’ | 1} ni, + 1 + j rs. | ; , 4 i ot} : f ‘ ye 1S. t d i ) + 1 t | ) 4) ae ‘i ’ ’ L : } 7 4 7 { } on ) r , ’ ’ , " ; ii ‘ ~ 1 4 . / } ‘nN, : ’ ° H | : o, : + + , WY 11 ] ‘ : ] om 1? ) , 1Y e 1 4 4 1 4 1 , } “17 | ? ’ . , } } + { , ] i , , ’ } ' ' an ? r r Lie , * a i Ah { . \+ a - — aa } aay | re ’ | dv ta al ° aah Pile i er ’ ref { t John Henry Lo ie + 2 . # } + ' 1 a nd cl i tr + + ce | | | { , ] ( ern ifter, Picture inc ) { 14 tee irtical i { , 1 } lB. i { ) ntern ‘ iL L& i ) + n | eet ) ( rty iy) 1 aot) : J 7 @ , OW + 1 dru et t + ry ne c ) 1 on ats - ; 1) yi ne ‘ J y tr ._~ tere 1 irsements brought forward S80n Funeral Mx wy é ‘ A : inera MOCNSeCS ; 85.00 fo 1 OWS: 333 | eA Aen enrteneteterteeeem Paid 2, lL. Hart a 7.04 Dat c ‘ . : , fev Paid Statesville Sentina} Co. ady . > ° $ notice of sale of personal property "2 B80 J } ey 0 Paid Tilley Summer: F, Paltd Rome y Mor an ° 0) " (eu i Paid Statesville Sent nel Cc fan Administrator's notice, = 00 abe some nt c ; Wewl Paid be Ae GALt) er, tr ry ‘ ae j Paid R. . Hollis av M. TS as: es . Paid 7 ) Y4 4 me : 19.50 PeLG is 2 Gi bs on Y . 0 H . ¥ ‘ , r : \ ‘ i Paid L. F. Dowell ae ae . y ‘ e v rw) Paiad M. ee h o0se 1) Yay { a. s/f) ved ih ’ oe , . . oe OI Paid ° die rist, 1 Ly. % rhe f ‘ T A vy os all 2 690 Je A. Harntness, Letters Am'r Mnw4 -«¢ 14 o . OoLal disbursements, Paid Cc. &. C. Final ttlement ‘ s ; 7A, } . ‘ ‘ . f Paid Commicsions on isbursementR?% Paid Commissions on receint Total disbursement: . Brought forward Cash RNeceiyt i Ral. due adm'r by state . ‘ rvs 4 . Be, a) } . The undersigned inistrator furt " ' a4 . i PUNE »W { { in adaddaiti t the ! } »} ] y | usenold and ki tel n tur Lur } ther ner nad ronert t t { 1a ! { ( ie@ into ee ccdany : . racuurer nas 4 ] t ire . 7 ar t * } Y I ( t . 1 tnuf icors, throu } it agent A. P. & t | . nD Ae Fs OLLis, yk ne ( 1 of \ iy wehty old an at aha { « 4 NubLlic auction to it fy } ebt t t thi ) { t t j ) ‘ ut ! PPAGO bs qa O¢ nothe n in xces »f thie Tey f f } , \ l¢ ) r’ ,eLE yy * t ( ry ' } f" i ( pt I] Le Py OL 1 Tile ner t { chan . \( niatraton a . ) ms S65 efor t,) t ) , f t iy of ovember, ] lL anita nn Tbilisi HONG. Us Be Ge ne foregoing final account of I. i. Cha » Admir trator [ee , A‘ . t 6 of Annie Lor Ps lec ed, ( yinant here nNportings n ‘ i ivin; een car il] ! ’ t } ‘ G Pod Ti ik IO, re y L) Over rie Iracered to be recorded a filed, ¢t vi er 18%... 2 i T 4 ] ‘ ws Ae Hart j / / ; (3 La K A } an e in a t e d Se e ) In the Superior Court, North Carolina, I Before the Clerk Iredell County. ) ° Y wv + t . AD LMOHT m lh _ TTT « McIVER, CLERK OF SUPERIOR COURT, LEE COUNTY: undersigned ~xecutor of the estate of Maggie Marable, (eceased, Vo-~ following as his fina sttlement of said estate: $395.19 1r walue, 110.00 44 e 00 costs costs creditors ‘ical service: r IO e 266.00 8.00 8.53 PF. Hall, Drug Personal and traveling expenses of Executor in looking after business of estate R. T. Weatherman, Attorney fee 150.00 McIver, C. S. C., cost of final settlement 7¢i8 sub- perenne Pe neers 4 T ‘ ~ J. A. Hartness, C. S.C. of Irece1y County, recording final settlement, 2 80 Aah. Boykin, Executor 5% commissions oO OT lections. egtitee 56.87 A. L. Boykin, Executor 5% commissi disbursements. 4 46.87 ry’ ( Total Marable Subscribed and swron this the 26th ad McIver eC; eh) ry _ £4 e = a “ ‘ T 2 rT ae The fc final settlement of A. L. Boykin, Execut of Maggie Man A able, has th day been audited, and the same is hereby in all respects pat ified and annroved, Th the °6th day of October 1921, D. Ee. McIver C. S. C. of Lee sounty. Certified copy of final settlement, as filed and recorded in this off ice This the 26 lay of October, 1921, of Lee County. B22 GIIG IO CABBVIIOIBA . on ~ X PPDBRRSDRS REBAR AAS KAY North Carolina, In the Superior Court. ’ Tredell County. Before the Clerk. an pe: Wy ali Templeton, Administrator of E. Mitchell, deceased.) TO J. A. HARTNESS, CLERK OF THE SUPERIOR COURT: The undersigned Aministrator of E. Mitchell, deceased, respectfully shows to the Court that he is the duly qualified administrator of the Will annexed of the estate of E. Mitchell, deceased, That the said deceased died seized and possessed of 298 acres of valuable land in Iredell County and left personal property amounting to over $1100.00; that said decocased was during his life time a prominent man and minister of the 60spel; that all of his heirs except Fern Mitchell; Fiora Dell Mitchell and Emmu Lou Mitchell are of age and that said minors are represented by guardians; that all of the heirs including the guardians o” the minors requested the under- as much as %215.00 for «a monument. HTORIM Cyrene ” 4h DIU Nel c s4IN LwWe said request said amount was spent in purchas- onner, which your petitioner believes is worth the price paid, and is no more expensive than is in keeping with the promin- et the rn. ¢ ona ao . as ence of deceased and the value of his estate: . ae ; = me o oO JHEREFORE, he asks the court to approve the purchase by him as adminis- trator of said monument. This the 28th day of October, 1921. aa __ 4. J. Templeton, een. te . Acninistrator, ca ee eee BRS 2 100.900 ae 4 2 ” X j arron & Conney, etary) ! ; os ‘ ] on + + eV / Unon reading the forecsoing apnlication of 4%. J. Templeton, Administra- Pearl 14+ ee : } i ‘ us itenell, Guardiar Joan 4 . ; ; tch / i - ete : ‘ , : ; ag . Lc y . / | tor of ™. Mitchell, deceased, it is found by the Court that the amount of cn 110.6 aa ' i . 4 : | a = - + “ 7 as) nerman + + ” i “215.00 snent for a monument for deceased is not unreasonable in consider tion i i ae an . 25 On Lwve s 4 ‘ GVe VU ed and decreed that the purchase of said approved and confirmed. ; pila atin tly Me ission or 7 56.7% tohe r yr Guan of T See as ‘ ; 1UTA 1QRO A ne » tormer Guardian of E. Mitchell, deceased * 1009.72 ne 480200 7 . , “J . 7T r try ’ 2 l de - lempleton cash rent 6 for vear 100° Administrator te for year 1920. nee A. accisaliah eri myn TOTAL ® 1134.72 to and subscribed before me of October, 1921 JW. Sharpe _ Cc Dept. CG. S. C. T A 3 c : is _ Templeton, Admr. was this day audi- nae pon | > wuperior Court, Tra q | tredell County. all respects approved, 1Q0 1921. In the Matter ] Fxecut f the Hartness x cutor of the ; ys } ° Ul Cc ” GC. Sa Us in ’ bursements made weatherman worn AY 2 subs this the and day « y SR TH e Ba n a ae ee ne e ai n t Sa a t at i d et i a m ep ea r n e r In the Superior Court, ? Before the Clerk. . , ™~ \ Ff e tt IAV iC y} } f y Davi ) . ) r " TIM 7 YOTIDD AD I I I ald 4 sdasalr \ * I ss P al\ \ Col Ui \ dlls ce he ave Veal dud ae > 3 3 ad IA Tynwidne + +4 Rat Dar ! ( nistratr ( ) Davidson yy etiti Y + f vVaAViIC ) ’ nistPra \ V + to f 1 4 . j 7 ++ T¢ e 4 is 1 stratri A I % 7 . f ] ) LiuUluls £ ° Ane f sale : r Ke Ne +t IO e OO n c 37200 total r LS. 442.50 ry ocr ) J de nr 4 69.00 , 7 oe 4 27 a) ? e * 25.00 ; ° j 1 nT . Del A wy \ ‘ Ue sot _ " ai . ei 3.07 IA 7 15.00 A - e JU 1,00 7 nC e fe m e' } a + Yn 43,00 ? ° 10.00 FOTAL | # ye —————— ILOeWdt { 1 + + 1 1 4 Ow ° 1 4.11 ( tmnt w 4 . Pn 1 ac 5 ‘ 124,11 trat, ‘ ’ ut I i 1¢ Y m TE one ‘ y ) ’ Ms 76.00 . nD . ”~ : ettie Davidson, — ( > for + 4 Ig Lat} r of vemnbe r 1071. ie . wor Yé sais T) . ¢ ‘ ) Ue We , Oe , 4 ) ‘ 1 ¢ i: — 7 t ) t C WAV I | Nn, administr trix Oz2.-AGy. I 7 4 . 3 a Ne ¢ il 1 er > c l resnect nnroved by i€ and 18 L ecorded. + ~ . : c " rtness J ee Be C2 fs, Restatement and correction of the final Mrs. anc co Mamie &. settlements 1921. The total charges disbursments Less Balance on hands Nov, 20th, balance n Statesville Cotton Mi 1 Statesville ampton oll ohon The 15 shares Oo 40 s 5 shares Total above wy 5 0 se i al e n H nl! be charges. rr ar thereafter, in the allowed 1908 composed of should Wad Was 1 par value Flour Mill par value ercantile Co. fg. Co annua up to settlement for 1908 ge} a accounts Nooe for the years 1908-9-10-11-12-13 and 1 for each ye the have been the following i and settlements of 14, and annual accounts 4 , fh period ending October lst, Pets i ‘ec have been 41% 98 0 ave been 5» 261.70 ; ce : ln ta in Un Cm 5 shares in Belton lhifs. Co. Beil 3 wt. 4 wate t os 1 share in Chiquola Rs Co. a iO anne T ane , Rin 2 sharcs in Bj,oomfield lifc. Co. 5 shares in Paola Cotton M:lls Total investee in -tocks., “s ghia BONDS PR . U. S&S. Bonds at ita + m ain J. T. Gardner note secur ) orteaar " " " n Barapis unsecur "” " " ” " Cas 4 ha s/ ste ade ye ae mash ’ ° ‘+. - 3 1 t. 7 » ~ ) \ } .« © Ig Btock which is hay las cas thr hout this acct. Total es ner above balance. Ne Of the. above items the 5 shares f Paola sto w ned low nar. Later, in 1917, it reach yar a I then s« of its, sale 1 have charged myself wit: interest on the J. T. Gardner notes were doubtful, later I cl from said notes 1d mortgage the sum of ‘3600.00 I these notes, but from the date 4. was a 1 t firect a iyself with interest on the amount received, in order interest oharces I am ad icting from the above lan the non interest and nor vicen ner anc st ‘ oy 4 . rc ~ > r rardaner notes of Lt 0 e VO € »! t f o') 2.125. IO de 17 tio} : ‘ Tear tri r a7 681.02, From and after the date of the year om Wro 7 YY G if te r t ) + ¢ _ t . le¢ T t Pe 1 stoc tardner not i: ve recharred +, e item: r nart « state. ‘ 5 nae ee , ek res re du L walt aivas ad NOV e Ot ] OS ° 1 NC ‘ r 4 P e OVe dy ba a 14 eb. 22nd. Bio field ri. Sieg aend : Tt .. ’ . > - « ’ . J inril lst, Hampton Mer. Co. f t - C. rj nd. T e : “ ¢ [Lp f f ria : July ] St, Cy iquola I -i,°0 Oe LVi enc. iT ” Tr. e zs Belton M4ylls. ; " ‘fy . * “ Tes ! Statesville Mills ‘ " ” t 1 °7 ’ Four 4 1 Aa] ” : te nr ® Mgllohon &e Coe A» " ny ns Li 1 LU © 3100 1i eld i Rite Co. " " YY WIT AMRNmMAN + Wetalens tovernment Ponds. — fr " " Pick Yl n " " lov. ‘ Interest on $3,781.02 13, __4,475.68 _ a 11,606.02 i : > age 1,500.00 ' 600.00 , 000.90 a 5 iO. 20 ie 500.00 ¢ 1 00 OC Os 10 50.00 ; mtd) 0 oun wh BE 900.00 af 9965 40 uae ‘ ‘ eVvV / * 3 ‘ 500.0 i 4.91 -) i awe = gk: eee f a fs 11,806.02 we 4 1 i, Higa Hi) ee an ; Naas ) viaendas rit NAS DeC= 4 Bs ‘aE G it, and from the date ad anount received. The Rig t t 1t1 out receivin; P terest WE er paid a a +1 mnt | ve ch rea t eep mi ecount as to AB : Y 1 are ie 3 f November 20th, 1908, ‘ ) 4 = i + . T 7 B os Je Le ) ‘\ + \+ « 1 de J us - f+) 4 y+ ¢ + 9 Li ) I Jy fs eOth, 9. ei the 1 tnent of te e iu a wien othe ‘ae | | i oe 4 ‘- ° 4 9,681.02 oc ( ‘ 22200 d 20200 i 4.00 / 60. 90 i 36.00 fy iV / 20.00 j 3.75 | agp | 3.200 on 0.00 re c 3.78 208 2 DTTC IIT PMNA WI Lierdsal .dastd bs Jan. March 7 a i . Cc GC. Trees t a+r Mor vise oO Q Vv Ty7 v7 Oo * tN Cash for year Launcry for vear : r child T.4 tan Fr Lh wees mS Ait Oo o a o c Ot (O o o oO o gO , reapers ae 2 452 el , . ee e fe r re s - ee ae en n ee en n eRe nes AR Ws atance on A} x. July Ist Cnhiquola ; : : elton - VUVUil State vo " " B loomf Trede 14 ee nn ce c c e a n e t ie r = 10,107.00 42.00 60.90 ( hg 11 20.00 59,962.83 nique (fe. Ce 8.00 60.00 raola on M: ; 30.00 30.00 Sloomf d Co My 412.00 25.00 Hampton Me itile © Fon. Ly. 20; 200.00 5.00 Tredell 1 de <6) 4.00 20.00 elton tO 20.00 8.00 Criquola M 8.00 Broomfield 10.00 36.00 Ties ad Statesville F 411, J » 1915, Apr. ae ce n SS cm u n i s e n m e n l ge e n Chiquo Mfg. Statesville Ry onfie A Statesville >. tt ™ a4 36.00 i] ans istic 10,857.42 oe orm avd wre 104 <O0 60.90 90.00 70-00 20.90 39.00 27.00 e. 9 As e JU 5-00 5.00 7.00 130.00 70.90 7 721.10 Oreos sscisltA tal TM cians we "r 795.55 AG c 1914 *10,062.07 48.00 60.00 16.00 30.00 20.00 8.00 290.90 8.00 29.00 18.90 _. silelZ ~~ ¥10, 761.79 60.00 85.00 569.990 090 000 aD oO 090 290 50.00 ent 640.75 34 099 Fd wcecieotomennid 602.78 88 6 TE ncemnene $10,159.01 1915. 510,159.01 20.00 8.00 18.90 6.00 26.00 Statesvi Chiquola ! Belton Statesv On Feb. l Co ey stock into that amount by principal of my this entry at have entere Prehiun Tntercest » hand d 19] 5 and "otal charree 2 & Grocer? « Meats Tor Flour and ry goods Shoes Gf vo ft gy 65 6.090 116.20 70.00 52.200 Pe 835.51 2° 7 09200 2912.58 . 3 ~ AC O La Sa Co oO ° o O ° 0 ye » 7 i ee ) ene aon me we eases 9.11 *13,84 oes wer Tas4e «(7 + 1 - LAaULe - . - - ‘ i IT . : 6 a 4 164h. 1920. I sold the «tock in the States- CREDIT RB LLOWI NG Nate On jan. 15th, 19<0, oO ri eal ad ; qT] XP DISES, Oe mn tam Mali at 3162.00 per share, which with the in- Vile " te eee et er ea a 1 . herewith charre Jame ‘ ST os 66 440 on es rn - , 4+ natted the eatate 984. JO above nar, T here ith ¢ hay re LIT) fia 226 MCSs, ee abe : MM * wae an Pan nannann?s ; ; - - : . otton Mzylls Co. was re Ln YY recordi! LMC. "9.909 } } TY yD . . : . . : sold the common H. P. Grier, Attor he instalments accord- erwvi : c " ° 1 i a ie Dus ) ave charged myself ith mmission Ove. 2 : a - : Tm bs ain = : Rll ilicceccicicscen } ; NW hal: a ‘ i © / ) common stock I was et balanc t cle tS t t { 4 a nn ; . ‘ ( A QOA ane af 0 , . 4.¢ 1 oO the par value af »100.00 ) . ¢ ? ettlement, I will append ? NAMM on Rand, and the par NOTE. The above a7 i teas 'sl1s stock. 280.00 > share f comm t , eles a ae 24.00 5 shar f o t in Moll I — a oe : 589,40 l share of common r : beheaded 115,613.67 1. S. Liberty Bo 100. ry » vear endins ert Ist 1920 oa oko ii L . i J ; eG . . 4 ame Nia +4 . , , ots % « ! j oe 203.18 ‘erred st 836.72 836272 _ falance on hands Oct, ist, 1921. %14,987.89 ee — cs ek a CY i j = e j : | 4 j + i - i | 2 | + | : | i z : ‘ i : : aa d j . ¢ | i 2 é } - | « rk ; | 4 . | a ; + = > | ry Ic ; . . 1 3 o r> =| = : |e —d = _ st o . io | e ’ = ~ é ; : { > : = - £ D ,* e ri « } 5 b + £. wi t + » G ' I. ; a e | s ‘| = . : : c i ¢, ‘ ‘| zi 5 > «| { e - ‘ j . ; b ¢ { } ‘ . 5 ~ c : 2} t] | ~ a C C, > | : a. O : - ' i | = < , : c } + : " E + G. | | + eo ¢ D ; 5 a oS oe o Co n e e > Y . 5 ¢ £ + ¢ P | : t @ - = Ss ~ oh : + > r ~ . ¢ Be es : ° ’ ES I < ¢ G4 oa - aa $ be + - - “ . , ¢ 63 f + o ; e > ~ < o ; - “ . S . : - - n ~ - = 4 q c I é a - “= : © r as fs a a C si a ~ = é . ; : a t + . - : ~ : a i i nn < + . f ¢ = 3 - C ij - . . ¢ + oy e i R a . > % aa | c r e ¥ x © f we +» © od = 4 ~ : & “ Ss @ eo n : “ > ee on a . ‘ ° e + . . + q . ; . ; . . ~ s q : = f a a ¢ ‘ e . i C < - : . 1 Sy . - ’ ; - : ~ - . : ‘ P J GK e. 7 [: 7 2 k . . : + 0 e ci © . ¢ ‘ 2- 2 e _ ¢ TY = e 5 _ ~ » po _ sa e J > ( G+ oC . ~ Pu e s - , - 1 S ‘ 5 ~ . / . ~ - C - _ t . “ a ° . a = ~ be y m C e > a e =} ~~ a — a) 4 re — GQ YS om ry ~ r f c = “e ra ° S 5 ., - ; 5 . ~ J + ° ° : - J ~ & or ’ t . . ~ - > e Cc > n c. G4 ; € . . 3 »~ am » 4 . r — - ot es . \ ; 2 : : ; . P . e > a " ; t F A { ‘ C & : 2 : | } | ‘ j j > ° < | | s ae r i ' © g : : ‘ i i oe ¢ } 7 to l : 5 > | . , i c e - ' j y a | 7 : c | i \ - i i ~ | - = ( « j ; : | } . je - : 3 . © . . a . . ° 7 . * . . i + " = R os “ & t ‘ P ‘ C C3 r ~ i? { a ‘ ‘5 » C ae . : : > | : ” x ¢ i : ‘ . t } 1 a: a el « : . ¢ | } 4 so e | - ie = rs Hi } ' | el f c t : j . _ ; ; i ’ » ” g ms | ; i? } ae + 2 i ‘> : i a , ‘ N) t ; : i° 4 24 | | CO : , a © | | : : ° . . . . o . j . j y ; : i | jt | . r r r j f | | i ‘ | e | | ~~ j 4 c . = “ i + | ; . e e ‘ 4 : . : i . je - : % “~ ; ‘ 4 ‘ : Sia n . t r el a s : ) ° + . z . . . S - e 4 . + 4 a ' , r . <1 C im ~ eo en n ee s . ep e e | es = a a — =. a va oe r A TO ~ Se aa : ane s SS S a a = = = a ~ we e et ea e ao e a aa a vi s i ~ ic a em ee a — es —s la - a = a “- lA AA ei ET — = == : i oe - oo — ee na n a me —— — aa y ea n SE S en ne a r ge e e t e m e e e n e r re e n t e r ea t ee s a —— . —— ee a RE Ra tm i ao e co m e n t ne — Synerior Court of Irecel) County, No : VN, Y) Tane n vane le personal ve iperial Furn. M iredell Pp a sal propty Pg. Co., dividend. County, sale law cinight, fees, - McDougald interest refunded. 14, Dr. Me R \dams, 28, Dorman Thompson, of interest advanced on her notes fee. Executor of Miss Before the Clerk. SAT RTTAT SETTLEMENT. Le et ad rth Carolina: o of the estate ving as correct roceeding 60.00 145.46 12.00 324.00 100.00 34.36 5.00 Jennie Caldwell, in AGW. by R. 3B. McLaughlin % $40 (4.7850 f June 18, N. P. Holmes payment on sale of auto June 15, G. L. McKnight, fee. July 1, First National Rank, dividend, July 2, Statesville Ralty & snv. Co., dividend, July ll, atesville Chair Co., fees. Holmes, note on auton a Bil Holmes, aitomobile note Fowler, on 1920 hay crop. Furn. Mfg. Co., dividend, Holmes, automobile > Qn Le UOey Nov. 14, Total charges check Kel ly . ey National Bank, Laughlin to ensone No. 8 ity Treasurer, City postage for adm 10. Mrs. Me C. watts, check issued to her by Rw 3B. McLaughlin irs ~- 74 - Florence Yhiting, acct. ces rendered. 1} ser 12. Malls Snoe Co., account. 3.90 3. Mrs. R. B. McLaughlin, agent John McLaughlin, money due John 20.00 Jan. 29, No. 14, First National Bank, note and Jan. 31, No. 15, W. P. Beayer, fixing lock on office door. 76 Beb.-1, ‘Horie, Dorman Thompson, services in S. R. Holland Guardian mtter, employed by R- B. McLughlin before his death. 100.00 a 250.00 15.00 40.00 35.00 115.00 100. 574.6] 101.44 309 June 18, N. P. Holmes payment on sale of automobile 3 250.00 North Carolina, ) In the Superior Court. June 15, G. L. McKnight, fee, 18.00 4 he Clerk, le R Tred: Lt G suntye) Before the lerk July 1, First National wank, dividend, 40.00 9 o —_ i 2 . ie ; 3 July 2, Statesville nalty é inv. Co., dividend, 35.00 gi In the matter of the Administration * PP LEMEN'T ( RE ' om ’ ‘ i 1. Fetate of Re B. McLaughlin ad PARTIAL SET? LMMGNT. \ St 8 le Chair C een : i % the Estate of + CLAUE re n July 11, Statesville Chair Co,, fees, 115.00 7 | deceased. i July 19, N. P. Holmes, note on automobile 100.50 a ae cr : July 25, 5. R. Holis ard as ie : To the Superior Court of Iredell County, North Carolina: JULY @0, Holiand, Guardian, refund of ove: nayments made by R. %. McLaughlin settlement of RP. Haiieana 4 ‘a : % Be a : — “ee a J . . 5 n sment « . « Holland mard « " John A. Scott, Jr., administrator c. t. a. of the estate of Re B. McLaugh- , y | : : lan. 374.6] 5 lin, respectfully returns and shows the following as a correct statement of Ae Si s ; a Sept. 6, N. P. Holmes, amitomobile note, 101.44 i his transactions in the discharge of his trust: ie a eae ae ee Sept. 8, Je W. Fowler, on.1920 hay crop. 85.13 CHARGES | Oct. 7, Imperial Furn. Mfg. Co., dividend. 12.00 i 1920. : wr oa yp i nr ‘ ‘ c. 17, To cash on deposit, First National Dank, ‘ a Oct. 17, N. P. Holmes, automobile note, 101.50 Statesville, personal account. > 419.28 . ; Oct. 25, Statesville Furn. Co., diviend 50200 ih Doc. 17, To cash on deposit, Fyrst National Mank, var4 1 ttorney's account : 3388.64 , ae ae a aa rey - tatesvil e, attorney Ss account. oe Nov. 14, T. A. Mott, Executor estate of J. J. Mott, Fee 150.00 Dec. 20, Je Ac lartness, C. uo G* fee in special proceeding — Total charges. 57115.6 ee j Phifer vs Phifer. 50,00 ae | +, 20, T. Je Conger, rent r office. 2200 CREDIT BY GENERAL VOUCHERS AS FOLLOWS: ae j es 0 T A & ( ec. 21, 0. J. Alten, fee. 5.00 1920. Dec, aT. BOs la Ce 1. Hartnes: ; CG. S C. costs i , I » 22, J. B. Foster, house rent. 25 00 letters testamentary. 3.88 t Dec. 27, Are ither, fee. 5-00 Cc. 17, No. 2. 4. P. Beaver, onening safe. 3-00 eo ) | || Dec. 9 Me lite, fee. 15.00 1c. 21, No. 3 Iredell Ice & Fule Co., coal for use of administrator 8.00 - a 29, Ts oa ¢ yrusze I» rer co FE z=” offi 20 2.00 / on j - ’ : ' Dec. 22, No. 4. Dr, G. A. Lazenby, check given b R. R “cLaughlin to J. P. gsngram and 1921. endorsed by him to Dr. Laxcnby 4.627 | Jan. 1, First National Bank, dividend. 50.00 ; Dec. 24, No. & W. T. Nicholson & Co. T 1 t 7. ae , - . " Yan. l, {rst National Lif y i ctor s per diem 10.90 payment on funeral expenses. 200.00 / | . Jan. 4, Statesville Cotton Mills dividend 9400 Dec. 28, Noe 6 First National Bank, check . given by R. B. McLaughlin to Kelly / Jan. 4, Statceville Furn,. Co., salary. 250.00 Clothing Co. 6.25 1 Jan. 22, Statesville Re lty & Inc. Co., dividend, 40.00 Dec. 28. No, 7, Farst National Bank, Check - given R. B. McLaughlin to L. ©. Stev- “eb. l, I iperiay MuwIN) « ff. Coe, salary. 208.33 ensone 6.00 ; Peb. 1, T. J. Conger, rent on office. 2.00 C. 30. No. 8, City Treasurer, City taxes. 44.35 Mch. | , ds ? ‘ H4) L estat Oy, feos e 100.00 Dec. 28, No, 9 Cash for posta ‘O for admr. 050 La in > t ' 5 ‘ T redel HT “lwo re P a , Mch. 18, Re L ve rede] lardware, fees Lioe 9 Nee, 31, No. 10. Mrs. M- C. Watts, check , ’ a ions issued to her by Re 3B. MeLaughlin 50.00 Mch. 25, Geo. '). Hawn, refund of interst advanced or him on Jane Viceery note, 60.00 Dec. 31. No. 11 Mrs. Florence Whiting, acct. " ae for services rendered. 16.00 “26, 'O sale personal propty at office as per rcale list 145.45 1921 ee serial Pur Mfr. Cc : , 7 ; Apr. 3, Imperial Furn,. ifg. Co., dividend, 2.00 Jan. 10. No. 12. Malls Spoe Co., account. 3.90 Apr. 5, Treasurer Iredell County, sale law books 324.00 Jan. 22. No. 13. Mrs. R. B. Mclaughlin, agent 4 Aw D j B J n 20. 0 Apr. 6, J. Le McKnight, fees. 100.00 for John McLaughlin, money due Joh 0 Jan. 29, No. 14, First National Bank, note and | Apr. 7, T. . McD ougald interest refunded, 34.36 int. 1003.83 Apr. 14 , Dr . Me n . \dame , feo - 5 290 Jan. Sl, No * 15, W. P. Boayer, fixing lock . eTo a Apr. 28, Dorman Thompson, Executor of Miss Jennie Caldwell, refund : on offiee door . ‘ , oe ' : “0 f, ‘ ; ) of interest advanced on her notes by R. 3. McLaughlin YR 40 (42.7815 ‘“S°) Bebe 1, Mo%46, Dorman Thompson, services in Mes 8. R. Holland Guardian matter, employed bi by R- B. MoLughlin before his death, 100.00 yn oR N 7) $17.50 from estate of M. A. iihite retained by Mch. 10, F. B. Phifer account (No. 1 ‘ rh. he fatanes ti A arta ie a ner Fur oO 7.85 2 aoe fem Ah, BOn Thy Coes ee ree June 20, No. 45, Dr. J. FE. “cLaughlin, pay- n 4 ment on note & mortgage. 300.00 Mch. 10. No. 18, Statesville Print. Co., acct. 4.00 . T ; , June 22, No. 46, W¥. J. Lazenby, costs 4 r ° Ramse' Bowles Moori son Co °%3 . n B , - e 9 eA r : ys Vv 7 r Mch. ll, No. 20, Ramsey, ¢ ’ 38.95 case Benj. T. _rump vs. +recell Vul,. Co, on account. : held by R- 2. McLaughlin, Atty. for plain » tiff. 2.40 Mch. 26, No. 21, Henry Adams, drayage use of as vic e eo Ps ° ~~ r » i L.dministrator. July 18, No. 47, Yr, Jel, } cLaughlin, pay- i ent on note and mortgage 200.00 Mch. 25, Noe 22 Rome Gray, cleaning office for scl men é &é : ‘4 , f ria sale. ? July 19, No. 48, i. T. Nicholson & Co., ar 1 Cc 11 funeral expenses. 12.41 ae Mch. 26, No. 23, Frank McLaughlin, acting as . balance on fu inera xpenses 112.4 a vile Uy e * wali 5 00 ; : Fs ee clerk 8% Sate. ; July 19, No. 49, sy ee MeKee Co. account, 2.98 a se , i. & Inti oO oP Y f es ‘ ™ - 7 Mch. 29, No. 24, Clerk apest ee ypgeotgy Bot gy 1.50 July 26, No. 50, Dr. J. E. McLaughlin, special proceeding sale law books. of balance on full on note & mortgage. 123.56 ale — ' 00 a. N 1 Meche 1, No. 26, J. G. Nichols, auctioneer be July 30, No. 51, R. G. Dun & Co., New York, ‘ a sia — onan’ refund of costs & retainer fee advanced in a ee 500.00 case Sawyer Biscuit Co. vs J. K. Morrison, on note & mortgage. fs suit never brought. 30.00 Apr. 3, No. 27, J- Re Poston, box use of os Aug. 1, No. 52, J. A. Hartness, C1 rk, ioney administrator. pi due C. P. Carter & Annie Carter on sale of ny Cn ee canta Mayet ain ts Bradley land due out of funds on hand as fi \pr. 5, No. 23, Ramsey Bocles lforrison Co., ae attorney, See Special Proc. Dociet No. 15, Sat Bal nee of account. OBel. p. 60, Clerk's Office. 500.00 a A . ‘ : e . Le +h > of will ae m cs : a ; : : H Lor. 6, lo. 29, re . Ce fec S, probate Or will ost Aug. 16, No. 53, Mrs, iy TT. ¢ tike eathe r, { “h4 + tors amount due her from funds attorney on settle- Apr. 6, No. 30, Sherrill & #hite, xeucotors, ane. 166.82 3 refund on fees in sottlement of J. 4. | rr. ¢ i : ; eens RRRSS name > 25.00 ; | | iIhite estate cover work not comple ted 25290 Ug. 30, No. 54, Sheriff Tredell Ce. 1920 | / Shave ameter tees a. tax on MCLaughlin & Lowrance places. I146 77. ae re 7 , Now SL, We +- Nicholson & Yo., on | ll ‘ .wne es Ae . 5 . ; funeral expenses. 100.90 Aug. 30, No. 55, Sheriff Iredell Co. 1920 : r ~ . Individual tax. 59.78 ! Apr. 14, No. 31, Dr. J. Fred Anderson ! alance on ote & mortgage. 662.11 ik. 3. ic WR: Oi. Cartes, idtereck ov | Bradley payment, on hand as attg. as per i . a aT > Qn . re Bf. AY ’ > ~ dv ? = j ipr. 16, No. 35. Yarolina Motor Co., acct. 4.40 voucher No, 52 35.63 Apr. 28, No. 34.Dorman Thompson, Executor of Sept. 6, No. 5%, Mrs. J. C. Steele, payment Miss Jane Cladwell Esta e, amount due 200.00 sf , ; : On on note. 200. ‘rom funds on hand-as attorney. 925.00 5 =f co A Ss Jaws lk 4 : H sept. 14, No. 58, City Treasurer, sidewalk, : a 20 N ‘ a well coem. w . 4 , , Gf H Apr. 28, No. =! Lazenby-Montgoemy Ndw. Co., 16.08 assessment corner Mulberry & meeting. 2.73 account. 4+Ue Jv 2Q¢ N ee Brady Printing C acct 3 45 Oct. 27, No. 59, Sheriff Irecell County, ) Apr. 28, No. 56, Brady Printing Co., acct. v oSO 1920 taxes on home place. 45495 4 : or NT zr Maace Nan f N - g + 1 O00 A g ipr. 27, No. 37, Miss Nora McNeely, account. 15.00 . No. 23, No. 60. Mrs. Ada Murdock, intere +t —_— a ; 6 months on note 30.00 May 2, No. 38, 8. G. Dun & Co., Jacksonvil'e, 3 | le refund of retainer fee & court ae P . ” . : es 7a ae == = a ae a Nove 26, No. 61, Mrs. J- C. Steele, payment 0sts, advanced but never used, East Coast 100.00 ; oe i. ee , ; on note, —s Produce Co, vs J. K.-Morrison & Co. 50.00 ) 3 \ 92 State "0a Re ty & inv Bay 19, No. 39, No. 39, Mrs. Ada Murdock, int. veCe S, Now 62, ta esvilic Realty . . . ; on note for 1 year 50.00 Co, account for insurance. 21.38 i A7UO L ze . ‘ oe) De 2 . A. Hartness, C. 5. C. June 2, No. 40, City Treasurer, City taxes on sant, Poth et cb art 9 “ee Lowrance place 1920, 8.32 >osts this se mente My $3 2 collections 165.37 June 10, No. 41, John Stevenson, work at MY commissions on 75307. 4! , office for administrator, 1.00 My commissions on disbursements & og 0 June 10, No. 42, Frank Chambers, hauling for v6101.44 at 5% Ley use Of administrator. 250 : 2 June 15, No. 43, R. G. Dun & Co., Baltimore, Amount due’ estate. = Md. refund of costs & retainer fee ado vanced for suit Victory Sparkler Co, vs J. K. Morrison, not used, 50.00 June 16, No. 44, Miss Sarah White, money due Credited by Special Vouchers as follows: No. 1, Apr. 28, 1921, Richard McLaughlin, on legacy. 2, July 25, 1921, Mrs. R. B. Melaugh- lin on legacy. 7 t Sept. 6, Mrs. Re B. McLaugh on legacy. lin 75.00 Sept. 15, Mrs. R. B. McLaughlin yn legacy. Oct. 19, Mrs. R- 4. hicLaugh on legacy. 6. Nov. 15, Mrs. R - McLaugh on legacy. Rpecial Vouch ae Est ALE e 15.00 lin 16.00 lin 89.99 eTrSe Swonmn to and subscribed this December 20, 1921. J. A. Hartness Examined, audited and approved and recorded, Yecember 20, 1921. A. Hartness McLaughlin. C ordered North Carolina, Ir dell County. In the matter of > estate ceased. The following is a list of’ the March 26th, 1921. Name. personal property sold at pu! Article Sold young. Roller top desk Carlton Offiee chair, Office chair, Carlton Mills Web) Fox C Vance Jenkins 1 B. F. Long 1 Long 3 Cariton 1 chairs. chairs. Lothes tree arm chair, filing case. wire letter baskets lamp Amount e $21.60 4.50 10.25 4.50 4.75' 1.60 2256 10.00 75 «60 Dorman Thompson Legal blanks. W. D. Turner Legal blans. W. A. Bristol Legal blanks. Dorman Thompson We Bristol Desk Bristol Fruit jars. Mills Bowl Bristol Pitcher Paper Punch. Glass jars. Paper Punch. 1.10 ’igeonhold cabinet 3.30 Bristol Scuttle, tong John Doe 1, Of1 can Webb Fox Small table Amount brought forward. John Doe J. M. Sharpe Web» Fox Scearr Morrison lebb Fox 1 @eather box Webb “ox 1 picture , ‘ebb Fox Paper knife 7 7 Vebb Fox Ink stands Carlton Leather folder Sronce 2 leather folders a 1am Shore ha mer head M. M’ Morrison, 1 ink stand Sam Spore igre bill file J. M. Sparpe desk tray Js ie Sparpe 1 iron safe George Pappas Wardrobe Walking stick «10 Dictionary 1.00 ”_ Dorman Thompson 5 vol. S. E. eed. 7 $145.45 John A. Scott, Jr, Adm. c. t. a. of Re B. McLaughlin. Subseribed and sworn to before me, this the 26th day of March, 1921 J. As Hartness ¢. S- C. JIIBSIQO@AOE GIBEBE WIAA 360 361 pn North Carolina, In the Superior Court, Ire ell County. Before the Clerk. > matter of the estate of ) eo EV Ue 268s, R. B. McLaughlin deceased. ) John A- Scott, Jr., Administrator c. t. a. of R.- b. McLaughlin, deceased respectfully returns and shows upon oath that the following is a true, complete and perfect inventory of all property belonging to said estate, which has come A (a) Personal account. ' 419.28 | (b) Attorney's account. 5,588.64 (c) Certificate 2 shares common stock, Sterling Mills par value. 200.00 5 shares Statesville Realty & inv. Co. stock, par value 500.00 4 shares Imperial Furn. Mfg. Co. par value. 400.00 3 shares Statesville Furn. Co. stock, par value 300.00 3 shares Statesville cotton M41l1s stock, par value. 300.200 2 shares Carolina Parlor furn. Co. stock, par value 200200 o- . ¢ z : : . bee ag ‘ ¢ . 3 shares tatesville 90d Products Co. stock (Yorthless) oar value. 500200 yar value 500.00 cn ~ + + - < s o ey 9 te 3 =~ , C2 > 2 +> > j nares “trst National Bank Stock, par value 1000,00 ; 9 Wh , a 67 , Note & } tgage i Ge is dc inger Note & I'ortgage of G. C. Mills Talk 7 sa 1¢ » " " WOhn 4. Webb balance on note. 193/73 Household & yitchen furniture of estimated value of 500.00 J} 1920 el Buic Tar ing car. Ors D Office Property. 1 wooden filing cabinet 2 book cases. 2 desk chairs 23 straight charis 1 roller top desk 5 wire letter trays. 1 staple clasp 1 desk tray 3 ink wells at hi i 1 tin letter box a 2 oil lamps 1 small swWuare table : ~ bowl] ! 1 pitcher 1 glass 7 7 cl e 1 round table i i 7 srry + * pi empvuy jug 1 picture of Presidents 1 wardrobe 1 small cabinet 1 leather covered box “ith handle ~ broom 1 goard Law library of the estimated value of 3400.00 ? May 14, 1921. Administrator c. t. a. of R. - McLaughlin § LT » ¢ cmindidonttt._£™eruness C. 5, U, GQQW]@AL CVIBOAAL JQQOVGVAAIOGLAA WT n+} Con 14 a . tC Inv ntor iV 4 ar - - é , sOl rt i ort ae oO + UNE ior ou ° 6 Stewart, dec y > Clerk Iredell County. } ss trator? Froni proceeds in ee n s ia i n cultivator, to 4#i " deceased, sub- mA Ce A « Mil] Pierce Abernathy Will S4ype Vill Sipe As 3 sn ov e oe s “ a ea e a en t e r i c ye a r n i n g ‘ cS « 2s 5 . 2 - So >> "e *s co ' : ; < i > be > ' j f > S j j ~~ | 4 ~ a a4 a os > mh v | | af % ol a 2 = : : j : 7 2 e _ r ” | } . oy +» > ) ° De y } ey . . . ° ? a { ° 5 . - + + ~ * ; » « = a ) > ) 1 - - , _ ‘ -\ ' = > _~ ) | <i 7 = } 3 S » s Q . 4 | 3 $ - 09 } <Q : ; Q } | j Ls ¢ o f ‘ cS > . " ‘ - Oo g 2 be | - ae } | j j ¢ wt —~ ; © or C- = } . +. ~ of i ; | i = 4 2 >> . i j ' — - ‘ as i ec o a s ; 9 2 ! a“ * 5 » " > ‘i i i > ¢, “ © = po v ~ , ~ ‘ ° v 9 e + a e: se e me | . mn D S . * - e e : * S + _ a . 2 9 Oo rh e : : ° ) ’ ) 3 ~ M4 ~~ £. } - _ ) > ~~ ~ 4 c. . aa A i = ve : od S n i z ~ - e ~ oo d . - o 7 ae . | | ; 2 §& 2a . : 6. j c " a . ' : os C a 5 i t $ a ) , a pe e r { 3 : ) 4 | ° > : , ‘i -> . = ° r : r “3 . e ; ¢ } , © ” ‘ : ~ n” | ; * r + j a. a+ . = - ° ~ . . + = = ~ > x _ . ms + 3 ra 4 ¢ a - Cs iS ‘ ; . . —- ; . . i > ~ i ro . > e tn — : ° . . - r ; ) s ; : 2 oo oa 7 2 gy F . 3 . e ‘| >) e ‘ a ~ i ‘i . ~ ¢ ° a a . or a . a : * 7 ~ " oh nt 2 a — : ; : R ; ry t = ; 2 . . q “ i : e L . } i oO } $4 , O Di + ad & . ' - | a. ' i i i i i i -- } j ' ' = hp | i i HE DO O D W D O N M O N H M N O N M O N M N H N O O D O N W O uw WO M oO OO O O CW ] Sw oO im co at le t ! ) ™ Or i ww © NM A K R KO N O uw 6) Or t ei CS ¢ oO HO M wh {u s ~ {o o ,= = Oo . 6. 6 . Os Ce e Se e : €+ ' @ 6. 6- 8 - 8 © * ee e @ . - es eh , @- 6. 2 6. 9 © 8 . - co f ri o i) 2 oO Oo [& ot e © aQ A m M m e n tt lo fh 4 << =f > < O c 5 it Ce OQ a jw ay a ay a 89 9 | r as > . ¢ os + £ ¢ is ry ¢, ~ ~ og a“ ' cs Q > + + © c S S, et ck ae ¢. - >’ - fe o° o o C. - 6 DO C oO O d ac 6) ao = ; ~- % © ¢ ri o t oO Oo Or i Ee Oo De r i Ge 3 O- + v 4 el ‘ CG 4 AD H W O R A H K OS H A OD Le OF rH r e i P e t dg Ge r i fi - fi w ¢ fa ct 8) 2 _ v - ° SH OG AH OH B T O DO H C He l ea t Oo wa a } « ‘a ee oe ee Se e a ‘ i> CD Ae wt et et te tt a 0) (a S : ot ? HS ts Dt St : $= > Ne s ‘ j& fy G2 Au m AY Ay ‘ a2 { i oe a . . . ‘ . ° ee @ ° ° e > ee r * i { z i x m ie So O f h e t s o d c o r n a s c d 6c tt ; Os ! ae ie = ae al . ! > + Os e oS s Ds > + — se o 2 Bs 2 ee - Be 2 © 2 O es - < ie ‘ “8 C= « = c, wo t < js Ee M e r OM MH S AN E He m a mm s 2 i , t Fo = Sy Cc . . . | ¢ C e 4 : c “ 5 2 > + is “a : - © “ - ~ t. - 3 = on t a ‘ 4 . f oC cs : m 8 ‘ + Cc os } £ a - a e. £ c. £ 6 g: © ka . 0 r i. ; ~ . a od il e € 69 % Or 2 é~ ¢ < : - eS ' : S . ms c = Ge a: .| a nm ® rc e, nN +“ > t < + Ss _ * £ 2 et | 34 Bo r s ; ¢ Cr t ba y a {> c : be . : : , Or | £ < 5 c Hi t s ¢ . 40 - + 4 os > . ;} q - ce Fy a et f 24 Oo Cc aN 2 } ¢ . C Sh c o d de Cr i e d Or i g b) - 42 ' 2 S 40 oF 4 e4 2 4 ) 2 4 x . mo om = 4 on - x " ot e 5 - 3 he ‘ Ss ) O & ¢ “o O on 2 ® 2 om — je oe eit an d jak as se as | & — 3 : . £ : > a aA ni c ri et me e e dt ne n i ni e Se t e ae d ri ” e e ’ mr i c i r o r x { 5 : —— : ee — a ns a — — — —— SS TT TT ee e aE IE T S ne e oa : sn c r e ie SO I C NU N E S PEE R E D NO N N E re s ‘ € +m atic Cc ™ * * v3 CQ . +. * © . ~ ° 79.60 59 IO 368 A ialeiisidiiiiei tice Final settlement of J. R. Pope, Administrator e¢ t. a. of C. R. Kelly North Carolina, deceas@d. Tredell County. 1920. i Receipts In the matter of R. 4.) Miller, Administrator ) 5 an of the Estate of Mrs. Sue Beaver ) " 24 Sale of personal property 111.20 R. A. Miller respectfully returns upon oath the following as a true Dec. 3° Sale of personal nboperty 180.27 and complete inventory of all the property belonging to the estate of Mrs. 1921 e ¢ 4 ° Sue Beaver that has come into his hand as administrator: Sept. 30. Sale of cotton : . a ee oC > > a Certificate of deposit, Peoples Loan & Savings Bank » 95-00 Nov. 25 On Lee White's note 1U. S&S. Government liberty bond, par value 100.00 Note and mortgage of V. 3B. Miller, principal 2058.60 4 chairs, 2 beds, 1 bureau, 2 shstands, 12 Quilts and a , a dT 320.9 a small number of dishes. ; sbi ements, int, sia Si, Rp A. Miller ! 4 5 1 I fune expenses : 3 #107250 a-\@ Administrator. to and subscribed before me H. Mayhew, auctioneer this, the 10th day of March, 1922. Wal? H Walley for J. 4. Hartness, C.£.C& Withesses J. A Hartness a - “ue : 7 1 Ows ¢ 2AO1INnt Clerk Superior Court. Cowan, account McKnight Auto Co. ace H. P. Deaton, legal not . aie ” cata DYIGABILISSHYE FIBIIOGOBIO HM. H. Goodrum North Carolina, Recording sale 7 T) i” Iredell County. Le. Duckworth, , x nde In Re G. R. Mills, administrator P. Alexander, of the Estate of J. E. Mills INVENTORY. > H. Goorum &C ace deceased, H. Goorum & Co. on account 7 ~ r ‘ o We he - mar TO Hon. J. A. Hartness, Clerk of the Superior Court: iithers, med acf€&t. a aa * ee ; . ® MoNe- pan G. R. Mills, Administrator c he Estc of J. & fills, deceased, re- « McNeely, accte ne spectfully returns and shows upon oath that the following is a just, true and M. He Goodrum & Co. D inventory of the personal property belonging to the Estate of the ‘ ° ‘ T) hauli : 2. le 26 ich has come into his hands as administrator, or into the Duckworth, hauling cotton & mule feed a & spRin ~ / erson for him: J Pope, 5% com. on $1302 receipts 65.10 " " " " “392.14 disbursements 14.60 re Hartness, C. 5. ©. cost 7.31 A 2, K, ME Administrator of the Estate of J. F. Mills, deceased, V. Turlington, atty. fee 22.50 Guardian for Philip Ketly under wil! 800.00 Sworn to and subscribed before me Mary K. Pope under will 86.556 this the 6th day of March 1922, Jennie P. Selly, under will 38.56 J! * Hartness Clerk Superior Court. Plato Kelly, under will : Total disbursements 1311.32 aaeceasesqqRqR00 @83088800820.2008 dé Re Pope, administrator c. t. a. being sworn says that the foregoing settle- : Sept. 10th Record of C. costs, “5.56 ment is true and accurate to the best of his knowledge, information and be- January 24th. Phythian dues R. |. Freeze 12.00 . " . lief. 50th. Peoples Home Furn. Co, Burial expenses 350.00 J. R,. Pope : ' Feb. Srd W. D. Templeton stamps Sworn to and subscribed before me this the 9th day of March 1922, 200 Feb. 6th. G. 4. Johnston, painting. J. A, B. Goodman Notary Public ‘ Feb. 19.90 2nd. Mooresville Enterprise, Notice 2.80 Feb. 2nd. Taxes, Town of Mooresville 77.42 @2@DYGIIAGASASISOSIWI9SIIOSOOP March lst. - AADAS - Geo. A. Morrow, Attorney fee QQ@BIDIOIBIWDVIGSI.IBIWIIIVIIII 25.00 March 8th. Mooresville Marble & Granite Yorks 45.70 April Othe § B Brown & Co. Mdze,. 58.24 forth Carolina Sant ‘ ,- June 18th, ! E. Wilson, Physician for R. “. Freeze 6.50 Tredell County. June 18th. Miss E11: neélius, nures 15.00 In the matter of W. M. Freeze’ and Mrs.) AT Sallie T. Freeze, executors of the ) FINAL &CcouNT. 1921. estate of R. i. Freeze ) Dec. 15th. C Morrow, Attorney Fee To Hons J. A. Hartness, C- “+ C. Clerks Commissions and costs ¥. M, Freeze and Mrs. Sallie T. Freeze, executors of the estate of R. \- é livided » Joseph A. Freeze and Cora oa + tr Vf February 28th 1922, balance due est Freeze, respectfully returns and shows upon oath, the following as a full , equally between ¥. M. “reeze 5A! penta ae na L. Freeze 5742.79 true and perfect final account for settlement of their transactions as such executors: Dr. Sworn to before me shares Mooresville Cot. Mill Stock 53000.00 shares Mooresville Cot. Mills Stock Pref. 400.00 March ls shares of M. & F. Sank Stock 1300.00 The foregoing final account « S. Sallie T. Freeze March shares lst National Bank Stock 1000.00 executors of the estate of R. w. Freeze gether with their vouchers hav- March lg shares Mooresville Tel Stock 100.00 ing been examined and carefully audited by me, is heret »y approved and or- March lst Bond 4th Lib. “oan 400.00 ‘ dered to be recorded and filed This the 28th day of Feb. 1922 25 March list. note Mooresville Graded Schools 5000.00 J. A, Hartness C. ©. GC. of tredell County. an May 10th. 1 note Mooresville Graded Schools 1000.00 May 10th. 1 note Mooresville Cot. Mills . 4000.90 Sept. 16th. 2/3 Interest in note of R. P. Vanderburg 1000.90 : Total Receipts %17200.00 Se ee ee —_—~ we eee erg whe: BLD DIBDILBE PE IAIDADDYPA>D Ap IBS Cr. 1920. Transferred to Mrs. 2. W. Freeze, according to the will of R. W. Freeze, the following; 3000.00 August lst. 30 shires of Mooresville Cot. Mills stock August lst. 4 shares of the Mooresvilte Cot, Mills Stock Pref. 400.00 August-1st. 13 shares of the M. & F. Bank stock 1300.00 August 1st. 10 shares of lst. National Bank stock 1000.00 August-lst. 4 shares of the Mooresville Tel. stock 100.00 August-lst. 1 note of the Mooresville Graded Schools —— 8.000200 Total ~ 10800 -60 cettldment of A. B. Harwell, Administrator of W. R. Harwell, deceased, Final settlement of H. N. Troutr executo alk a a "=" cutor, Vd tne estate sf 2 y " 334 »Q + ie aie a ie a 3 es Receipts. 4 man, aecease Gy, made thi: ‘ Oth jay of Varc} 19°e2 v . VISA 4 hig Vee gh : nts from farm 998.15 he nds 40.00 8.53 " ” " 40.00 RID I RY L] T] aS, ° 5 ee ¢ ¢ : “ " ” " 2.00 ive 3. Je A Nic Oolston 2 ) sas} t ind ot) " " " 50.00 No. 3. Statesville ntinel { e to credi+ ess Harwell, sale of car(note) 500.00 4 " " interest 56.50 ; 30, Total receipts. 5819.7) NO. 6. d \ Harty ess thi: ett Le nent Disbursements. Nos Te H i at ans Hartness, C. S. Ce, cost Ww os $ 0 8 o n i = re co > Oo > 2) : , AL ak . on % 19 é disbursements 9.75 Mannt " t I \ Hartnes: : c C cost 1.00 “ ‘ " = - 1 a i a meen ~ eat 4 amon t . ‘ , 4 4 e ¢ . ‘ varwel A nistrator being sworn’says that the foregoing settlement standir ; bt Ss funeral e2 and f administra? ric stat exsersissteienmnentntee LD cn aS NU AONE cen einen i ‘ . ube ribed before me th j the lst Gay of April 1922 ne ef } SOworn ) a ibs ribed beiore me this tne oU Gay oO ADPIily om @ 70rn j ] . ¢ f ’ } ‘ | on Cc LL. ~- ? . ee “ - } o. We. BOS DS : 2 . \ Hortness { eee ee re ER Gene nS cel cette ent oe a ee { T n ” c nr _ - = > ¢ 4 Vet a se we /«@ se 3 s* of Lreaue 1] . es * Audited and approved April 1, 1922. ‘ + 7 t= a = . a 3 4+4one Because f failure to collect one note, the adm.nistrator asks for one addition Ll yoar in which to make final settlement. —A-_B._ Harwell The above request is granted and the time for making final settlements if hereby extended to April 1, 1923. WOHOOMOCQOLBB2@Q@OOC A alam - A ON I C. S C. \. Hartness_ CDAD AMAIA SOP IIA AAT DN AI ANOKA IAF D, (AMD NK NNDB AY NGS DORON ON AS AAD . Inventory and sale of the personal property belonging to the estate of ikeleather, deceased, as made by his administrator, A. W. Blackwelder, Will Goodman made in the spring of 921, and the greater part of the Total amount of sales e ono eo ‘ a a a 1& Qay OL October, ; . arlkweln . ngan Sw jer \ ¥. Blackwelder, ng duly sworn, depo that the Article Amount. zz is a true and correct lis " the articles of l property F rd artomobile $255.00 ; prope J the estate of W. R keleather sold by hin im &s8 administrat © fy ~ \ Ne e n a ee e ee e ee aa a ae yr ) togeth } with g 1t received fro the Sun 4 bes of >; knowledge information and belief, Harrow : ultivator = —~ SS S ae ap e n a s eg North Carolina, About Zé ves and bee } : 4 + “oahn? , “hea ‘ ;Y?Y bhall) OuUuSENOLa Afni enen ilurnivul estimated value worn to and subscribed before oe Ae Mattock Clerk Supe porn Basket limber Fodder Seat Hay Hay rake North Carolina, dell County. the matter of Mrs. Lillie Sneaks, Administratrix of t ow" Aan € sgl Rdwards eceased. We par} a 1144 WW c aye Lillio M. Speaks, Ss LT} LIST. 4 A\dministratrix of T.W Superior the Clerk. . Edwards, deceased, 1lly returns and shows upon oath that the following is a true and cor- Oil can Mrs. Sherrill of the sale of the personal property belonging to the estate of T, Bed stead Mrs. Bost Table & C. Mrs. Bost ceased, sold at public auction by said AdminisStratrix on the Saw Speaks Saws and table Bridges 1921: ' Hammer 7 Speaks 12 bee hives “a Pope bee hives r. Speaks bee hives W. I ope bee gums L. Pope bee gums W. Lentz bee gums T. Speaks bee smokers I T. Speaks t bee fixtures. F. W. Lentz Ioney ext. - T. Speaks 6 bee gums i Tom Box @ .25 Beaver - Automobile 1/2 interest Ch s. Poovey Safe Tom Fox uM Ichaels ; Cupboard I. T. Speaks Clock 1. W. Mahafey Hastsel 8 Sundaries -T. Speaks 3 screen doors E N. Lentz Everett Combs 1.8§ l cow muzzle W. CU. Perry Vice T. M. Waugh Sherrill ‘ AdZe F. W. Lentz saw J. G. Nichols w clamp Tom Fox plane Tom Cashion plane J. M. Waugh planes Raby mallets T. Speaks chisels S. Shoemaker frame T. cpeaks awl 1. C. Perry square M Raby box and contents it Nichols wash pot T.Speaks Purchaser tm NA M O Pf »A ‘ rt pu Oo E. Michaels yp PM R HP N U N N E PO Y Total Lillie M. Speaks AdminiStratrix. Sworn to and subscribed before me this the day of March, 19:2 ccseaninmaniintanerestigjieiliidiies MUNI ili Dia, Clerk Superior Court. Speaks Sherrill . Snow ; ; , ame se Campbell QQV@OCBIBDBA SLORB@Q@Q@QDA QOVIIGGIDILIDIGO IBEW Francis Reavis Mrs. Sherrill ( Final account of A. W. Blackwelder, administrator W. R. Stikeleather, deceased Johnson made this 22nd day of March, 1922. Col. Nichols ; CHARGES. Tom Fox 6rom sale list 4 350.350 Milt Waugh ash from cotton crop of 1920, sold in 1921 257.00 Tom Fox of cotton seed crop of 1920 27.50 T, Speaks ash from sale of cotton crop of 1921 100.00 Perry C from sale of cotton seed for 1921 17.25 SeaZ Perry Cash from Clerk of Superior Court for sale of land 341.05 Hat rack W. H. Dingler Sale of mule, Clem Chambers sect ee icin $1,113.10 o ho 4 c f Roe ' « Cnalrs Mrs. BOS t Total charges Oil stove F. W. Lentz Heater Will Cash CREDIT BY FOLLOWING VOUCHERS. i, McNeely & Co., casket etc. $108.35 walLt Mills & Co. act. 17.61 ", V. Veils, J. P. Costs, in suit of Mrs. Stikeleather 8.10 S..Talley medical act. 32.50 Brawley Guano act. 32.50 Ostwault act. 12.50 Nat. Bank Mooresville notes (balance) 8.00 Rankin & Co. act. 42.73 v Carpenter act. 35.00 orirst Nate Bank Mooresville Miller note 68.60 er. Ke. Ostwault act. 1.30 eTroutmans.Drug Co. act. 3.09 S Laurence Miller mortgage on automobile 221.44 14.Mrs. Manda Mills act. 12.00 eds We Stikeleather corn 5.00 6.Thomas W. Bass corn 5.00 17.S. H. Houston fertilizer act. 86.74 8.lire. Amanda Mills rents 23.40 ot’. P. Alexander, sheriff taxes 1920 10.34 MN. P. Alexander, sheriff taxes 1921 10.46 j. Stikeleather corn etc 10.00 T. Hager smith work 1.35 ytice to. creditors 2.50 R. Mills autctioners 2.50 4. Hartness, C. S. C. letters etc 3.85 T. Hager sale clerk -50 Hartness, C. S. C. this settlement & Inv. 7.00 Grier, attoney, suit of Mrs. Stikeleather 30.00 Grier, . fees 50.00 Total account. 7843.39 — < 55.66 t 5% 42.17 / on 51,113.10 Receipts at 5 on *'845.39 disbursements a and commissions SPECIAL VOUCHER. ry Stikeleather in compromise settlement of years allowance and distributive share in r dece se husband and special vouchers and costs s ” inistrator one child, to wit: G , and Mrs. Mary Stikelather ntroversy his widow was entitled to he llowance igainst the administrator for her years allowance be- decided that she was entitled to said years allowance of uppeal but the parties immediately compromised years allowance and dower by paying Mrs. Stikelather dower interest and all interest in theestate of her late ecuted a deed to the said G. /. Stikeleather conveying her he lands of her later husband to him and released the admin- ‘urther cliams against the estate. intestate left 34 acres of land, this being all the real estate owned by him, said land is situated in Barringer Township, Iredell County and is worth not exceeding 25.00 or $30.00 per acre. The exemption to his son is in ex- of the value of the realestate decended to him and there is therefore no oritance due from the estate as I am advised and believe, Blackwelder, after being duly eworn denose: and correct *, Stikeleather deceased, showing the as ¢« ilnNis of any other person for him, together with t all to the best of his knowledge, Sworn to and subscribed before me the 22nd day of March 1922, > A rane Yr PrP, ALexance! nsurance premi Nhite 0/11/20 3. First National Pank, Noe 4. Dr 0 on life - & 7 f White 10/2/20 ment and account in final trator or which should have mount which ec | Nead come into his hands or into ‘he hands tne @Sbursenents and commissions, information and belief, F. L. Sharpe.money aavancea No. 5. Statesville Loan and Trust Cows { No. 6. Statesville Loan and Trust co 7. Premium on life insurance on 4 ’ Stikeleather fo 963.11 weg VVUVeda 75.80 insurance preiums 10.00 Admrs. Bond 10/24/20 26.67 Admrs. Bond 10/24/20 26/67 White 10/25/21 40.33 No. 8. First National Bank interest 2/15/21 4.00 No. 9. To money advanced A. A. and settlement on filé. No. 10. Je Ae Hartneses, Ce F A, Tomlin for tuition board, clothing &¢., be ore appointment of guardian as shown 267 (1.5 Fees for thie settlement. L» is t e TO on Shere $2,768.88 35.29 at 5% h25 200 ‘s and commissions $2,929,10 4 J al Me 4 + + » my 3 + 44,16 § 461.92 $50.00 __ 2¥RB3x2% X4929xt0 2,963.1) me 22969210 nad corr a settlement and account of the state of | } : wnt) “Aed 1Q20 a es eC y 4 period ndi April 10t ly VGaLey how tyr the I pe! I ived r. r y ? ther person ior ras administ i hich : lle have ee! ‘eceived, and how the ame : : 4 re 1, ¢ awa 104+} CQ stratrix. his April 10th, 1922, ne ae M. Je TOmlin id as ix Cs 1. Dom] 1b i ¢ f - 3 64! J . 4. Lo be o YoY 4 : Fe acini tear cima ima praienienaniananmnentataa tit ited and ; ‘ <= : iz i ily ° } 1+ n c Qn os ms t a . ~~ @ 4 4 . 4 y £ wet Té i ° ° ; Xx ‘ : P eceipts. OA : 1: 4.1§ 7 . ows i "Ly 137.05 € Ay f Li eorV 4 at C Yo e tO { ) 50 ‘ mI eV T c "yy . f \ 30.00 ce . t 66.84 * 34.01 a Le Amon + ~ Ai Ad ’ VV 19 ~~ @ 1. Q 3 a " “+ Se , . én c nr ie . io id ‘@ . ° . . . . ° . ° ” C . 1¢ Lé¢ > " ‘e he ii@ ~* . ' ie © . + . , . . * die . . a) 1 © ° . “ . . v¢ . + . i bul ner mar? CSS, f witnse 90} Lea! Reaver aver, lay mn . ’ u ~y rm ? one € { AVI vy 4 if n, , 4 ; i =? 7 4 ° , ° . T ‘ 3 . * A 4 ’ ° . ° ‘ ’ A * 4 9 A ’ a Ally ’ c , vil ir. xanacer, 5 rawilie€ , & 1 nneriy, ville Fur Rives, ing Nee 1 & COs t a WVe { . . Sé t i Lad y . *, . es . . a ¢ . *> . 4 . | y e ,s ‘9 irance ver Mra, aon es So e ee a Re " PR N ee r a Ne i 382 “ye a Yr ? , +a . © c . 4 + % ‘ 4 Rfe r 7 & T T Tor Monti Yr’ 4 , . et ; : ; a [as ge ade f iG, Ot al) “& e@ 50 1 i y x : . . > T Bo ‘ 7,49 receipts ce © - é . Brawley 5% com. on [$1117.49 receipts 55.87 nee , se ot : cat Mc OQ Az jehurse Y o°¢ Zz 10°07 oe . Be % wle J ‘ Cc he JOO AO At ¢ ‘ ts 69.15 ae @ . J —_— SS Cc »LO4 i eOt . If « , 4 + . e FR: 7? An 4 } ‘ na ol% & i pe ee ee ce it a “a * at 1192.00 4. { ‘ | Oedc t m i ‘ t . tt "” 7 $ 4 z Rra wiley : ig i aie. \le of hay . O61 i a | : i y ' t ° ’ oe " . «* i i E ve& Le yt} 1 7 & 4 + sal +ie A & l e! ba zm Lh ‘ t 7 7.04 i ; 10° & 1¢ 4 wee Ai5se Ve f . °o { 4 ut oO 68 \ . . 4 44 ‘ . . . . ° +4 } "7 e ° . 7 7 sd ® . ‘ 7 4 . + ‘ io C7 1 ! 4 ° * . + + { . e ° ras ‘ i i ee ere nes a0 WZ0 OC " fs ever i 4 ph ; i ’ 7 " ne Jae . } 4 ‘ " 1 i s 4 i > I LO&eO/ © . . . i * . * a) y : t Pe of é ) 1 ” Ce? “ ‘ ; " ! > ft ) } e e- . =~ © . = * * i fk ta | oo T r ’ . | - ) , 7 ‘ \ . ‘Se Re ° A 7 . a . _ 7 9 : 1 v ) 00 > ae - | ; * . . . | l . 16.00 = ) ' : j . , . | ; " 7 y > ‘ a i ve 2° . ’ 7 } | { t t t LE } ‘ ‘ ; ‘ 4 4 : ” - 4 c AS L . . 3 we “ i ‘ i " 4 1.70 ° ° . ; Le fld 1 4 4 ” « . . : © . « t . . 4 ’ . . = : ' ~*e VY *e a . . " 4 , “ . Bats , 60 : t ’ 1 : 2°74 “ry 414 4 fa 3 . + 4 ] 1 tt ‘ “ - ; n ] é ° / E . L/3 nl : t ” is vas . . . . » . . "s L , peo sew e inn : 1 7nN AN j ‘ ° le e ° ° y V0 * . * . . J ° i , ’ } ¢ be Oo e . ° J = hie . ac ; © 44 1 : * e * . . ae * " . 4 j t . . . ’ L ° . i . . . 4 fi e y. a ° 1 4+ , ~ . . . . . ° ) - 5 } . + . . . . rn ¢ 1} ) . + * . . J Lowe ) 9 P ‘ ; > ° ? ‘ 4 + 4 yz 4 ‘ ~ - A L | . : , 4 wr wy ° ° A Cc y » [ IG e@ OO ‘ 4 4 ny £4 " = % 4 4 4 ‘ . t i y fe ~ ‘ , a - . . — a LO. ‘ . ( ° tis burseme S ° oe 4 . * rs - x 4 +* f 1) . BOO 9-7 . . . . ) ihy . we awmias y an 417 ” ” io 5 nawley 0. + | os . . . ey UI j Mrs. : i ’ y t C J a7 a4 Ve A i > ' ra’ Lo AC (wd Rey 9° ‘ yer) wT a ‘ ‘ » 4S LY 692 r Ad. AUG Le « bra a / Total still due f. Bey Brawley $87 632 esidaaal 9) RE S ee , ne . - o s } i } i j be d | j od i 3s eC i : a ' . cr 7 ' ; a rt } | ° ° ie : te s wo } i ~ i = a & = re j | ; a = OQ ' ! } | _ ' i 1 =e O | DI ‘ - } } 2 t € ¢ uf j r j [ . -* > ee d = = e a fe ; — C> oO 0 C é { j oF >. > 7 . . . a > a +. * . o 2 8 . i i } ~ 2 c } j i 7 t ed r ; i i ee t j i ; on d Cc + on ve CN co c e ‘ ~ ~ n> . . © . . . . + . j + ie ~ - OQ r ‘ al l l + 5 . ‘ - . i if 7 | é S z ~ | . = . i r- e r ot ° - | £ } w > ‘ ae : | Q t * a ae s : i : é ig ° r = = i | 5 " on e tS . . - i j = . . s pi = } = = i 7 ‘ ‘ : i j i | e ° + _ i j i of - $ . i i | ; ; <x “ e i i . | t ‘ : j - ¢ Re i | : ; | i <s i ii } c | | ; i | i } ; i : ° + e - . | | : 8s =| v 5 ‘ . 7 7. e . . - . < = c . . = es ee e — . . . . i . o . - . ~ . . . . . + * . . . + . . . * . . . <n c e e e c e a n n ne n a : eC CO T O OO AA A A s —_ ee - a ai a a a a a re r e - aa a ee co m e t s Se k i n e ee e en e r ee RR NE E ee er a s e s ea n ma n e a r a n t 391 ‘ t a 2 = a on NE MP a in g e n se e é ae d S Se , - Na cs — — — — = = . . * . . . . a . . * a . . > ° < Oo wo Cc - <a cs J 7 . * 2 c + SD . > C2 sw ' . = Kn . ~_ - o wv . oe 2 . 4 S ° - > —“ c ¢ $. - * t. gS O : - rt t. . ~ ot . ri j ° . g S ~ = . S S . > pa t : a < z t . - os > o . . u o ° = ED -“ ye . sg ts . n . e * - 3 . 4 >. 9 > . . - . . . . . . © . m “~ . ak a k& ° as ct . . . . . . . . oe . . . > - ee e — Be me ~ 2 2 £ x ‘ G4 ot . . = or ae ; ! > . . 1} ° * 1 | i} . - i | is c i ° } if . i} + ° } + ‘ ; r i} ° i i . ; ; ‘ . . if " i | { i ' : i . - ; . ° ‘ . at . .* i. ej CN ? a | Li Se e ee RT E ea aE si n a : ~ ~ a an o . co t e e a a i a a i e d —— — E E E E E S Ee cr ea rt SR A EU OR E P SR R BE : ce s t a So e Se tuition for mencceenensnse : | : , , : i . : if ) ta tT + _ j ; ‘ ) | : 1% a - ° ’ - 1 + ie n O i Fs bs + ih if 1] ' ” \ cae i : a i . H as i 5 ‘ | e i 4 s 7 Ly ” ” 1 g ot fh — } * ’ " { 500.99 . 2 y » x i * , ' I Par value. 400.00 5 4 8 < ° " " ix ! aa 1000. 0 iberty ds. 500.00 1 ar Savi tamps Pp Yalue 500.00 " , wt id “ + , ¥ 4 Yr) Ar) T c Rantl ¢ ry ! j f De it on yple L. & S. Bank Par 1400.00 Notes and Securities. ny 4 mor+pa ve y Len? 7 a el mor ga 9 We NKENULZ. 420.00 1 Chattel mortgage \. E. Lentz for ‘520.00 Subject. Lo a cY Git of 5640.00 180.00 Note of A. L. Barvinger, secured by mortgage 840.00 4 ° 0 ° 0 cs ae 541.80 ‘ 4 Y P » G. J 100.00 ‘+ "7 + r 7 O17 a 1 ye 00 c q , — ° e 2 4 ; ' Il . , ¢ ; + . A . . pa 2 . s . , " ” ' ° Arse : oO; . . e . ° . 3 vy ® . ; : ® ; ‘ . ; . ‘ . : * age ‘ - 4 * ‘ " . l j 1 A ? ’ 4 i . Ap} ; y * r a) } A ' s ‘ 9 : yo vt ‘ . om na r) + 7 , ii 5 ’ I c AA +s ‘ tLiones ° AYA @/\ 1 >| ; “ o . a 5 ft . i ~ ~ e if ; . ps . ” . \ b e * - ’ an a thea "+ 4 ’ oe srio'ir Co ark. t. © ” ~ = = fe a ~ @® © + © c oH i SS © ; ~ uw ( uw C od > wD t C 2 ei c oO : o> x > > O > Od ? c = x“ . . . id . 7 . 7 * 7 7 = ° 7. - . ae - C > <t sD ) t- a> t ~ wo rt . - se v ee — — r wo re rs i . * _ © - ; } Ee 4 ~ j —= we - ~ i Yq _ = } . - > ° 3 t- © C2 es L c+ oo t : um 03 -4 « _ = i 1 - . - . 7 > . . + . oS . 3 4 ° co . * : : . 2 > 2: 2 > i 2 oe oa ) ? c, et < 2 at 4 i ra cs = - + ° x a || | 4 a Ru ir > a q ~* ~ + “ i < ~ Vv re e ee i} — A” S x} ~ > + : = - - e e 4 — x + > ee + rs 5 7} : | u J 4 4 3 Ss $ C w : i] S, co 5 > c c ¢ i i | = we o 3 5 ss | 2 S . G + 4 . i wo e << h. + < oS 3 . j 2 os * ; i} g ~ C i —_ — er a 2 i 3 4 - © $ L | 4 - o 2 é : i ra > oi a. > » . _ y ri 4 re on y cS ~ “4 4 + : - ce . « Go + - S : - 2 . - : c t : + ° Ww ao 2, © S > 4 . . c, - a cs v cS } ot x * 4 g ~ = = 3 a ° ~ 7 + ~ ~ we Sy D 3 oO na l = = 4 4 ~< ss 4 Cc % aa d a a © co ‘ t oy + + i . : 2 - . uw >) aQ a =) S 3 . > e ss s ; : or d ® ra i S . 3 ~ . e . e . . . . . v ° fe w ’ | . ° ~~ —— — — ~ S o 3 a a] Q D G . . , = a, > Sa © ek e “ m4 ca - G2 ¢ f, $, > a 5 . + ~ E t Sy . » c, ri 4 e 5 ci i ° ° . ° ° ° ° C. ° 4 ° ° a co ° t S4 > f = 4 > : > > - 2 4 > : > 2 Ge = * 2 nw 4 =) o 8] > a S < “ “ . » a YD . ry = a mt c rc wt = we gS v2 Qu RN 2 ei a Yo od @ 3 oO oO > < : = = = = o oC S a © & ct 4 re u © - = = = a ot . S - - a“ “ e wD ct 4 14 © > Cc . ° . . i 2 et - = 2 N 3 C & de a © ad . oO a oO a {x } _ . . . . * . . & D 3 eo oO a A ° uy oD 4 3° © S = BS > Oo 64 Qa - : ’ TE EE ET R E s ining after years North Carolina, Iredell County, In Re: J, J of the estate deceased, TO . THE deceased, full, just, as such Ne) Feb. li avn + 3 1 ty ssOLLulls ary .20 LWO mic enw 200,00 WA.Bristol, Attorney fee 300,00 ‘fe ew dh 1 oy mess, per cent on Wwe $ tOUCIOUYL age ne SD J Point ) LL s0Ol ae . + i tTatchet oo * . < / 4 “9 e estate of Yemins A9ed ° — Pre rs +} ~ ined administrator furthe 7 Jemina Hatchet lted leaving the following ery 1 7 157: 7 crys had F 4 Hatchett, who si entitled to ,E,“atchett, entitled to: Mrs, John Fox, entitled to: Mrs, Sallie Nicholson, entitled to: 575 irs, Laura Lazenby, entitled to: 1575 .F, Lazenby, entitled to: Emily Bass, now deceased, entitled to: 1573.26 ~e Z , TOTAL « © we me ew ee ww ww © © OL leeeL ,ocme hf “~e@ Said undersigned administrator further shows the court that on the lst day of Oct,, 1921, he advanced Mrs, John Fox the Sum off That Int, on said sum to date amounts to Leaving a balance due said Mrs, John Fox of « - $1,097.33 23,83 -_—-- - d “oe the 25th day of October, 1921, he advanced ee the sum c 55 9¢ Nicholson the sum of “1,000.00 being the balance hice” beet ree 46015 a F ‘as ributees of the on said sum to date amounts to 17.50 estate of Jemi lett, d v4 Se ALG L a re ; ™ tha OR+ awe . AV bpecn paid to vlance due Irs, Sallie Nicholson of ------+-+-+- 9 500.76 me on the eoth day of October, a” Sin baa : alan chy ° iL. to da te 9 a t] ae arene ae ns . : - invere t on same ) A and ne amount received this malraa na tat f Ay oer ¢ This r Same ; ures Otal of $1,575.26 on the 25th day of October, 1921, he advanced this the 18th day of February, 1922 : Toe l > eoOUuUl Gay Us Y ~ At, és v 6 “ts m Sh+hs @ Irs, Laura Laze PL 000,00 aura Lazenb: tnterest on gaid sum to date amounts to acne jue a Dalene Ge Mra. Leura Letenoy «+ < * ee ee te eee By | t} 9900.00 Receivec of 7 ' sO s od » <9 . mA + ee ee 5 d I { ot is , amounts to 17.50 in. full payment of the a? Weta Baan t o oe o . ol Oe ee Awe " azenby of « «© «= «=< =-=« «= = « §55,76 deceased, as one of the . ¥ oe r* 1,000.00 amounts to 17.5 wie Bai kehekt of ow i do we 6a we oe ee + YV : | i i220: ULISC Lt 1 ? he 25th day of October, 1921, he advanced / | , View en VOM~NaN . ~ ~% “ " “ 7 aes - i 2 7 r a - ee | thara o ue the estate of Emily Dass, ttorneyvy . — fo ee Pe ee omar ‘ rt y a 22 ne LOMANLS UPA ee mm c u a n n e n a i t a a i i i i l : mini ein. een aeanbce 2 he a t sbursements, th ee ew eiore me, 41,2 a a AAS -‘s 1 fn narann a UNLS tne Uf aay y ty rson o } y 922, . r Vw + any oo settleme of e. Sharne 7 TTT 7 ”T - 2 es tina A+ Tar af TT 2 7 oOo mh 4 4th d f February, 1922. — our ot PAMaAr ae Zs aeattete " 1 f _ ' ae . * ‘ ’ J,V,tatchett -OPCCoL 21n v. Eg ig y minis trato1z 44 ao 4 1 ce 7 S« , a > ; . - . dministrator, the es be : ‘ eo : : : Tae ’ state, showinh that said distributees have received full payment of reived of J,W,Hatchett, ministrator, the sum of (3452.10, bein their respective s! having b carefully e3 Ined, az “audited t} 1] ecco in full due me a ymne of the distributees of the estate of by me, is hereby approved and ordered to be recorded and fi Le . JvV9 le i 9 * e a¥ I¢to 3 1921, which with the interes on same to te 16 amount received this his the 6th-d May, 1922, total of $1,573.26, iT is the 17th day of February, 1922 JAH ‘ese ~ —T T yay ty Tt) of 555,76, being ALY e balance i ul VU a 4 the estate of f . . b rs - ° . ae oe a Oty Anu f l uly C ” : seo) VIL Achy Vo at : ee a z q $4 OTARY nt stober, Lt] iount ons on the ; [ 5 J stobe 5 ee i the amount redeived AV 4 « av ank<- liace Lazenby x es TD ’ "T ~¢ *.. a am , » ap y KeT.Weatherman, Atty. . roe i nistrator, the sum of 555.76, being the cee in full due me aS one of the distributees of the estate of J@mina e i C t ry + 7} Ae ad 4 NOON ON hawtne » @ * 1.4 oS) evar ves re ae by L,900,00 having be paid me on the 25th day of October sc oh + wrt +}, % 4 aA Ae 9 +. 1921, which wit the int "est on Same: to date and the amount received this date makes a total of (91,575.26, Th, 2 es ha ed . Sac $ > 4 c this the 6th day of May, 1922, Sallie Nicholson North Carolina, John Milholland Iredell County. C. Barker © stan " w 8 In the matter of the ) : Administration of the Estate of Dr. L. White ) Delmer Rupard lamp 1 small heater To the Superior Court of Iredell County: Dewey Dowell lean Mrs. Kate W. White, administratrix c. t. a. of the estate of D&.L. White, respectfully returns the following as a true and complete inventory 6f the Press Campbell table S. M. Madison sewing machine property of said estate coming into her hands as administratrix: ws PS Pharr hames Certificate of deposit, National bank Sumpter, South Carolina #200.00 James Baker . Single tree G. McLeod 2000.00 S. J. Shaver fork Samuel Pradley 450.00 Ww. D. Pharr plow stock Note of Fanny Albert 355.00 M. J. Jurney cotton planter Note of Elizabeth Smith 365.00 S. M. Madison plow stock Life Insurance Policy Mutual Benefit, N. 1000.00 R. T. Sprinkle Dixie plow Life Insurance Policy, Southern Liie and W. E. Filliams Cultivator Trust Company, less policy loan 478.00 Roof Shoemaker ” feet 5 shares Greensboro Securities Company 300.00 R. T. Sprinkle Saddle 10 shares Preferred stock, Armstrong Cot. Mill 1000.00 oC E. V. Weisner 1/2 interest drill shares Peoples Loan & Savings Pank 250.00 P. J. Holland section hire ; shares First National Bank, Statesville 500.00 Rk. W. Dowell mule shares Statesville Realty & Invest. Co. 500.00 W. D. Fiemster 1 cow 1 Fourth Liberty Loan Lond 100.00 Bob Holland 1 cow 3 shares Mooresville Oil Company, value unknown Ruff Shoemaker buggy irons HouseBold and kitchen furniture of the estimate value of 500.00 N. F. Templeton sad iron W.D. Pharr mee Kate W. White Administratrix of Dr. L. White. Arch Redman €offee pot 7 Vil i e. J. We. Sharpe D. C. Douglas bucket and dipper — W. B. Williams water bucket J. B. Holland ' range W.D. Pharr cuppard Will PFiemster : churn The following is a full, true and complete inventory of the personal R, Prevet kitchen cabinet property, belonging to the estate of W. A. Shaver, deceased, which has come Sherl Chaver bowl and pin into the hands of the undersigned, as Administrator of the said deceased, am Flake Goforth flour chest was sold at public auction on April 1, 1922. " 1" 2 jars PURCHASER ARTLCLE PRLCE. Trivette 2 crocks W.D. Pharr Reble s?tO Cash ; kettle Ed Shaver cotton cards 18 Shaver pucket salt W. Jordon wheel 206 7} 404 | North Carolina, Iredell County. if In the matter of the ) Hy Administration of the \ Estate of Dr. L. White | To the Superior Court of Iredell County: respectfully returns the following as a true and complete inventory 6f the | Mrs. Kate W. White, administratrix c. t. a. of the estate of D&.R. White, | | ty of said estate coming into her hands as administratrix: | proper Certificate of deposit, National bank , Sumpter, South Carolina »p200-00 q Note T. G. McLeod 2000.00 q Note of Samuel Pradley 450.00 iq Note of Fanny Albert 335.00 | | Note of Blizabeth Smith 565.00 i Life Insurance Policy Mutual Benefit, N. J° 1000.00 | Life Insurance Policy, Southern Lite and ' Trust Company, less policy loan 478.00 3 shares Greensboro Securities Company 500.200 10 shares Preferred stock, Armstrong Cot. Mill 1000.00 5 shares Peoples Loan & Savings Fank 250.00 5 shares First National Bank, Statesville 500.00 5 shares Statesville Realty & Invest. Co. 500.00 1 Fourth Liberty Loan Bond 100.00 3 shares Mooresville Oil Company, value unknown TS HouselHold and kitchen furniture of the estimate value of . 300.00 ) } Kate W. White i Administratrix of Dr. L. White. “worn to and sub cribed before me the 1¥th day of May 1922. se Soar pe Dept. C. &. UC. The following is a full, true and complete inventory of the personal ae r a ee n s eae aa a property, belonging to the estate of W. A. Shaver, deceased, which has come into the hands of the undersigned, as Administrator of the said deceased, am was sold at public auction on April 1, 1922. PURCHASER ARTLCLE PRICE. W.D. Pharr Reble «70 Ed Shaver cotton cards 16 W. Jordon wheel 06 John Milholland C. Barker " " Delmer Rupard Dewey Dowell P-ess Campbell S. M. Madison J. F. Pharr James Baker S. J. Shaver W. D. Pharr M. J. Jurney S. M. Madison R. T. Sprinkle W. E. Williams Roof Shoemaker R. T. Sprinkle E. V. Weisner P. J. Holland KR. W. Dowell W. D, Fiemster Bob Holland Ruff Shoemaker N. F. Templeton W.D. Pharr Arch Redman S. F. Goforth D. C. Douglas W. EB. Williams J. B. Holland W.D. Pharr Will Fiemster PB, Prevet Sherl Chaver Flake Goforth " " . Trivette J. F. Cash S. N. Shaver Chair 2 chairs " 1 small heater lamp lamp table sewing machine hames Single tree fork plow stock cotton planter plow stock Dixie plow Cultivator : feet caddle 1/2 interest drill section hire mule 1 cow 1 cow buggy irons sad iron coffee pot clock bucket and dipper water bucket range cuppard churn kitchen cabinet bowl and pin flour chest 2 jars 2 crocks kettle pucket salt 21.00 405 -10 025 3.12 17.25 94.00 12.00 9.50 256 50 15 63.50 2.25 5.00 «10 Sh a aE a o y pa r e s ee me n e es Staley Shaver Pperrry Holland J. E. Brotherton Mary Claywell Press Campbell Everet Williams Cleve Pharr Miss Garris tt " Clive Pharr N. F. Templeton Milend Templeton Ed Dowell " " B. E. Weisner John Cash B. Prevette Cleve Pharr J. B. Holland C. M. Madison B. M. Redman J. F. Cash Will Fiemster J. B. Holland B. M. Redman Fake Goforth B. M. Redman N. F. Templeton D. C. Douglas J. T. Holland B. Prevette Ss. F. Goforth J. F. Cash Arley Hepler Quincy Holland Miss Garris W.E. Current L. G. Lampert Table T.ble dresser 1 bed stead dresser pic. fame pic. frame iron bed bed springs bed stead ” " spit-toon 6 jars 6 jars 2 jars 6 jars wash pot shoe last half bushel cyst. steel drill hammer iron wedge wash tub lantern buggy hams cythe cradée waggon horse collar plow gear 4 jars 6 jars 5 jars caps paint 5 gal can 10 50 5.00 4.60 2.55 205 255 50 50 59 15 205 50 05 059 S. N. Shaver This May 135, 1922. Sworn to before me this the 13th day of May 1922, W. Sharpe Dept. Clerk Sup. Court. North Carolina, Iredell County. t. ceiling ° 1 buggy and harness 12.44 45.00 —e = oe ' aC ‘ sinning eile, Aaa Administrator, GID LGIITSLLIOIBOQ DIL ISS TLL IGI ARQ In the Superior Court, Before the “lerk, In re: A. C, Beaver, Administrator) of Mrs. 2. N. Beaver ) To honorable J. A, Hartness, Clerk of the Superior Court of Iredell County, I beg leave to file with you herewith my final settlement as Administra- tor of Mrs, it. N. Beaver as follo ws; RECEIPTS, From C. C. Moore clerk of Superior Court of Mecklenburg County from the estate of one, Mar#-Cloerzx as follows: Total receipts MIS Landmark Letter of administration R. O, Beaver, Distributor share Mrs, Addie Smith Mrs. R. Le Beaver irs, Amnie Goodin, F. E, Beaver A. C, Beaver Total SBURSEMENTS, 5139.10 7139.10 2,50 5.85 21.79 21.79 21,79 21.79 21.79 21.79 $ 139,10 A, C, Beaver Subscribed and sworn to before me this the 24th. day of June 1922, Ja Wa B pepe e + * We . The foregoing final settlement of /. C. Beaver, administrator of irs, Kh, N, Beaver, has been examined by me and is hereby in all respects approved by i 5 | Final settlement of James A. Chandler, Administrator of D. S. ceased, 1921, April 23. Ay " June 8 June 22, 1922, April 28. 1921, April 21. " 23 " 25 id 26 8. ll. " 19, 226 8. J. A. Hartness c Receipts, H. N. Howard, cotton money “110,02 Cash in bank 29,86 Sale of personal property 94,70 Iredell liilling Co, for corn 25,08 Sale of real estate 836.84 Total receipts, $1096,50 Disbursements, J. Ae Hartness, C. S. C., cost Observer Co., account Statesville Realty & Investment Co, Mooresville Enterprise, Administrator's ad, J, M. Deal auctioneer Dr. Se A. Rhyne, med, acct, * B, M. McNeely Co., burial expenses Farmers Viarehouse & Oil Mill, acct. J. A. Chandler hualing corn H,. A. S mith, acct, 21. S. 0, Lazenby, surveying 21, S. H. Heuston, chain carrier w Ww. P, Overcash, chain carrier 24, Zeb, Deaton, marker for grave ol, 1922, M, P. Alexander,’ dredging tax April 28, S. H, Houston, acct. for 1920 guano " vi May 18, " 26, Pirst Nat, Bank mooresville, Revenue stamps H. A. Smith notes J. C, Mclean estate, bal. rents for 1920, J, A. Hartness , C. Ss. U. , cost Chandler, de- $ 3.85 1.75 53,00 3.00 1,00 4,00 110.00 5.66 2.00 13.70 7.00 2.50 2.50 20,00 58,75 152,00 1.00 332.27 50.00 5.22 May 26 * " te Turlington, attorney Chandler, 5% com, on $823.98 disb'ts, t ¥. A.. A. Chandler, 5% com, on $995,40 receipts, 49,77 A. Chandler, guar, Robt, & Wary Bell 30,00 A. ed S$ Chandler, distributive share 30,26 Spears, guar, Alma &: Mary Spears 50,27 Mrs, Floren © Overcash, distributive share 50,27 Allie & Lucius Robbins ” " 30.27 Total disbursements, 1096.50 Je Ae Chnalder, administrator being duly sworn says that the foregoing settlement is true and accurate to the best of his knowledge, information and pelief, ‘i : J. A. “hander S worn to and subscribed before me this the 26th. day of way, 1922, Je B, Brown N. 6 (notarial seal) Audited and approved May 27, 1922, XXXVI QLQIOQODM OOO PCOCQTIIAGOIIIOSGIGASSOQ y S Yay 7Y “y¥oyY*y . KY ny IS IBIILIIILIISILILBILKIE North Carolina, Iredell County. In the matter of H. P. ‘dministrator C, T. A. INVENTORY, \ P. Barron, deceased, To Honorable James “, Hartness, C. 5S. C0; H. P, Grier, administrator C, T. A, of A, P. barron, deceased, respect- fully returns and shows, upon oath, that the following is a just, true and perfect inventory of the personal property belonging to the estate of A. P. Barron, late of lredell County, which has come into the hands of any person for him; CASH, ; Cash in First National Bank $ 970,82 Cash in safe turned over by J. A. Conner from Sallard 16,00 Check from U. S. Government interest on registered bonds 10,62 BONDS, 1. pond, 1st. loan, par value of $ 100 sold for 2 bonds, 2nd. loan, par value of $50 sold for $49.45 1 bond, 3rd. Loan, par value $100 sold. for 3 bonds, 4th, loan, par value $50 each, sold for 4 bonds, 4th. Loan, par value {/100 sold at $99.50 each Interest on said bonds The above bonds were up as collaterial security for loan at First Nationa “ank, and were sold by me at market price to pay off said loan, 4U. S. Liberty Loan- bonds, par value 1000 each 4000.00 These 4 bonds were bequeathed to Dr, 7. Grier Miller and I have delivered them to hin, 1U. S. Registered bond lo, 107610 par value $1000 1000 ,00 1 U. S, bond No, 201277 par value ./500.00 500,000 STOCKS, 6 shares common stock in Statesville Furniture Co, par value 3100 per share 600,00 10 shares common stock Statesville Cotton Mills par value 100 per share, 1,000,00 12 sheres of preferred stock Statesville Furniture Co, par value (3100 per each, 1,200,00 5 shares common stock in Statesville Chair Co. par value $100 each, 500,00 25 shares of common stock of Harness Vehicle Supply Co, ; par value of ‘3100 each, 2.500,00 10 shares of preferred stock Statesville Cotton Mills par value $100 each, 1,000,00 5 shares common stock Ramsey Bowles Morrison Co, par value 5100 each, 500,00 10 shares capital soock First National Bank of Statesville ? par value $100 each, 1,000,00 NOTES AND ACCOUNTS GOOD, One note on -r, T. Grier Miller, dated 9th, day of September 1921; due on demand, 1,578,00 Interest on same to June 10th, 1922 (at which date I cole lected said note and interest) 64,51. NOTES AND ACCOUNTS DOUBTFUL, One note of \\. E. Clark, dated 24th. day of September, 1921; due on demand, 10,00 One note J, i, Warren dated 22nd, day of December, 1921; due on demand, 75,00 note of Vie S. Poteet, dated 4th, of “ay, 1921; n demand, ° 102.00 INTEREST IN PARTNERSHIP, One relf interest in the marble business of Barron & Conner, value not ascertained, OTHER PERSONAL PROPERTY, Household and kitchen furniture, value ulmom, a detailed statement of which wil be filed when same is sold, H. P. Grier Administrator C. T. Ay of 4, Pe Barron, deceased, Sworn to before me, this 23rd dgy J. A, Hartness Clerk Superior Court, POC OP CE CCCECEOCE CE CC ECE OYA y > 7s) CGO PRR OR IS SOSA GRAS North Carolina, Iredell County. In the matter of J- C, Horton Admr, of iirs, Sara iiorton, To Hon. J. A, Hartness, Cc. 5. O, J¢ C, Horton Admr, of rs, Sara Horton respectfully returns and shows upon oath, that the following is a just, true and perfect inventory of the personal property belonging to the estate of lirs, Sara Horton, deceased, late of lpedell County, which has came into the hands of said Admr, or into the hands of any person for him, Household and kitchen furniture 150.00 Cash in bank, 400,00 yo00.00 Je C, Horton Adm, irs, Sara Horton, Sworn to before me, this 5th. day of July 1922, J. .charpe, Dept. C. S. ©, ATGAGAVELAGBAABSISLQ COOGAIGAAGAATGTAISIVE North Carolina, Iredell County. In the matter of \. A. Lutz, { Rxecutor end Trustee under the 4 FINAL ACCOUNT, WA1L of Esthere ©. lutz. Hon, J. A. Hertness, Ylerk Superior Court: We A, Dutz, Executor and Trustee under the Will of Esther C. Dutz, ree spectfully returns and shows upon oath the following as a full, true and per- fect tinal Account for settlement of his transactions as such Executor and Trustee. CHARGES, 1919. Balance on hands from settlement of January 135th,1919. v7.18 3/5 Received from sale of usther C. Lutz' farm in Davidson County. 16038.10 1920, Jan. 1st. eceived from J. L McCray interest on note of $5000, 265.82 June 30, J‘eceived from Charlotte ational Bank 4% interest on 355000.00 from “Yanuary 1920 to date, 67.68 Oct, 30th, Received from Charlotte National “sank 4% interest on 5067.78 from June. 30th, to date, 67.57 Total ——“"-TGi4e.40,.— CREDITED BY THE FOLLOWING VOUCHERS, 1919, March 6th, by check to “rs, “amie S. Efird on distributive share, $5000,00 March 6th, By check to “rs, +ula S. Dinglehoef on distttb- utive share, 5000,00 March, 6th, “or Revenue stamp on deed, 16,50 March, 6th, “or certified copy of will and recording of same in Davidson County, and for Quiteclaim deeds and recording of same in Davidson Sounty, 16,00 March, 6th. J.-A, Hartness, C, 5, f on Inheritance tax 40,00 1920, tax. Nov. 5th, To J. A. Hartness C, S, C,, costs in case of Inia Se Dinglehoef et als, V8 We As Lutz, Executor and Trustee, 10,00 Nov, 5th, J. A, Hartness, C, S. C, costs of this settlement, ff Nov. Sth. 5 commissions on {561.46 receipts for Seti ice January 15th, 1919, recorded in Book #11 page 471, of Settlements of Executors etc, 28,07 Nov. Sth. Commissions of 5 on 4554.28 disbursed in said settle- ment, 27.71 lov. Sth. 5% Commissions on Receipts of this settlement, to-wit: $16439 27 821.96 Nov. 5th, 5% commissions on 598,55 disbursed, | 29.93 Total . “LL506. 17 . Nov. 5th, Balance on hands, 4940 28 Nov. Sth. T. J. Ae Hartness, C, S. C, baa, in full on inheritance tax, 45.70 1920, Nov, 5th, Balance on hands ~4894,58 In obedience to a Judgment of the August Term 1920 In the attdnn en- titled Lula C. Dinglehoef et al. vs Vi, A. Lutz, Exeuctor and trastee under the - will of Esther 8 Lutz of the Superior Vourt of tredell County, North, Care olina, I paid to lula S. Dinglehoef one-half of the above balance on my hands and to Mamie F. Efird oneemhalf of the above balance as is shown by the fol- lowing vouchers, toewit: 1920, Nov, 5th. Paid to lula S. Dinglehoef 12447 .29 Nov, 5th. Paid to “amie F. Efird 2447.29 i A A IT xecutor and 1rustee, Sworn to and subscribed before me, this the 5th, day of November, 1920, J. Wi. Sharpe Dept. Clerk Superior Court. The foregoing final settlement of W. A. Lutz, Executor and Trustee under the Will of Esther C. lutz, deceased, accompanied by his Wouch- ers supporting the same, having been carefully examined and audited by me is hereby approved and ordered to be recorded and filed, This 5th, day of November, 1920, J. A. Hartness erk Superior Your rede vounty. @BIGBIBIFIGIGLIA @GQIBGIABIZTKITIGQ = ea s es aa a sa t PA T T E R “a n g e n , North Carolina, Iredell County. In Re of Thos, 0. Ervin, Executor of J. +.Epvin. To the Hon. J. A, Hartness, C. 5. C, Thos. 0. Ervin, Executor of the estate of J. Tt. Ervin, respectfully returns and shows upon oath that the following is just, true and perfect final account for settlement of his transactions eas such administrator, Reveipts. ‘he following was received by undersigned administrator from the sale of the personal property of said deceased on the 27 day of July 1921. 1 quilt % eS 1 blanket 80 1 blanket 3.00 2 chairs 025 R, cahir 1.80 1 picture 200 1 picture eco 1 picture 025 1 picture 200 1 picture ok 1 picture 025 1 picture 1.40 1 picture 00 1 clock 2.00 1 clock een 1 p ciure 205 1 hammer 45 dishes ~05 1 coffee can 200 1 butter print oO 1 jug 215 1 glass bowl 410 2 il, picture 215 Set knives 1.80 sundries 205 Knives and forkd ,15 oundriies e905 Sundries 205 moundries 05 dish oO Pitcher oO Pitcher 20D Sundries ea0 Ded Springs 2.00 Bed stead 1,00 Feather bed 5.50 trav tick eB eather bed 5,50 leather pillows 50 "W ! 1,00 Ww +i i.vo ? " w 80 : 95 : 1.50 : e020 Straw tick 205 -traw tick 10 Ded stead L,S Feather tick 3,00 Syndries ¢20 C stand 245 v, stand 245 B, dish 15 b,. basket 1.28 10=tub «70 D, pan 240 Pasket eed ' 10 " 15 e285 Pot .85 Pot 05 Sifter 05 B. pans C, can 1 quilt 1w uilt 1 quilt 1 quilt 1 quilt 1 cepin Coverlet 2 lap robes coverlet Coverlet 1 c# pin 1 cepin i: Be Yin Blanket Cemepin Cepin Blanket Cepin C,. pin 1 picture 1 picture 1 picture 1 picture Bible 2 yds. oil c, Testament Trunk Bible Lamp - 4achine U. S. Map Co map +able Ped stead ©, barrel “~undries 1 plate dish dish dish plates C, mill i, dish oundries Dipper C. pt lamp P,. lock Yish dish We pan dish sheet 1 clock table pictures Saw Books books “yreau GC. & VW, Chairs Se case Views ~ glass Yiews & glass B, Pitcher Lamp C, planter S. Ke. Cultv. Hay rake surn plow Anvil bellows “ash pot dish “ish Dish G, jar oundries n hades LO 015 025 1.355 «50 025 "7 ef 2,00 2.90 50 1.50 1.40 250 025 50 290 025 025 90 025 20 «10 20 015 220 5.25 25 045 075 110 «60 2.25 ~ LO 10 025 Piste) -40 »L0 -10 200 005 10 2 ec 015 205 205 ~10 85 005 025 035 of 045 ~50 »50 75 05 -40 205 005 2.25 205 005 025 250 225 1.25 075 2.75 2.25 5,00 2.60 -50 1.25 05 35 025 240 05 See ee ee e Cr er s ga a t i i o s pr e p r e s s sat a ys ee es G, dish S. goblets “ly trap cups cups », lock T, cloth Sheet sheet r. cases -~, Spread ~neet P, cases Yr, cases ~heet P., shames P, shems = ow Cc 7. Ss owels sheet oheet i, €l1oth « chair quilt quilt quilt guilt quilt quilt quilt quilt quilt ~ 4 2 re . cg + be ' PR R HE R E } ec ct ec cf tt A ct ec t GH P HP P PR P RP PR P PE P BP P RP RP P P E ? i, bucket we bucket sable Cuppard cook range cubbard table Lub 2 cjaors < chairs straw bed echairs 2 chairs 2 chairs - chair ish undries ug undries “yndries “oiler ~undries “an an ran “an Van 1dries ~undries M. chopper be Gish 7 @ bowl we tick S, tick S. plllows Fillows illows Lounge 20 fe Ke © t- e i oO re ~ © bt ed oO .70 205 05 © 05 1,00 20 «LO 05 05 O05 ~10 65 05 ws . 20 © 05 1.50 BL, ax 50 vafe 3,00 W. C, & “ha, 295 Pictures 205 S. & cradle 2,00 TOTAL cIS7,64 Disbursements, Letters of administration Crying sale £ personal prop, Inventory of personal prop, teaid Es. E. A., Matheson Paid Angeline “esbit Admin, commissions on receipts. Adm. commissions on disbursem, JimS. Hartness, C. 5. C+ tinal s, W. A. ~ristol Attorney fee, Total disbursements, 908.55 “alence on hand of administrator the will of J. T. Ervin, see will Paid to Alice C. Cook 7 Zoe Paid to anie S. Mainus 17.32 Paid to H. Clinton “rvin 18.52 aid to Samuel #. Ervin 7,62 Paid to Rqbt. L._Ervin 37,52 Paid to _s G. Prantley 17 . 5 Paid to A. Yenith aller 17.52 In Re T. 0. Ervin, Administrator, “sta The undersigned administrator ments; also receipts from distribut which said administrator herewith being a minor, without guardian. worn to before me this 8th. day of euly 19 The foregoing final account of +hos. 0- of J. T. Ervin, deceased accompanied by hi a a 3 the same having been examined and dered to be recorded, This 8th, day of July 1922, 5.85 1.25 ~50 5.00 7,89 1.51 1,00 15,90 book 7, ty 9 a i, ~harpe — -- ve Ve Ve We to be pid to disbributees as provided in age 543, in sixth paragraph. 1121.55 th vouchers for above disburse {th ‘aller the Yourt said A. Venith Valler tw o _ vin, administrator of the estate vouchers and receipts supporting audited by me is hereby approved and are J <A. Hartness GO. Ba We 418 " galt 419 Received of Thos. 0* Ervin, Administrator of J+ fT. Ervin, deceased the . The above named persons being the children, distributees, and heirs at sun of $17.32 in full pyment of my distribute of share in the prsonal estate law of said Angeline Nespit, of said J. T. Ervin as provided in his will. This July 8th. .1922, This 29th. day of June 1922, . 2.0. Ervin ie He C. Ervin Executor, Received of Thos, 0. Ervin, Administrator of J» T. Ervin, deceased the The undersigned executor herewith, also pays into the Court the sum of sun of $17.32 in full payment of my distribute of share in the prsonal estate (sare to be paid to A. Cenith i/aller, one of the devisees under the will of of said J. I. Ervin, as provided in his will. J. T. Ervin, deceased, Mis 29th. day of June, 1922, suis duly Oth, 1922, Alice C. Voal,. i, O. Ervin Received of Thos, 0. Ervin, Administrator of J+ 7. Ervin, deceased the sum of 317,352 in full payment of my distribute of share in the personal estate Received of J. A. Hartness, Cc. 5. C+ the sum of 55¢ in full payment of of said J. T- Ervin, as ppovided in his will, my distribute of share in the prsonal estate of said J. T. Ervin, as provided in his will, this 29th. day of dune 1922, fe ae This the '' day of 192 - / tke Le Ervin eS Meey—Lla_Overcash, Received of J. A. Hartness, C, ©» C the sum of 55¢ in full payment of Received of Thos, 0. Ervin, Administrator of Je ++ “pvin, deceased tne my distribute of share in the personal estate of said J, T. Ervin, as proe vided in his will, sun of 317.32 in full peyment of my distribute of share in the personal estate This the ‘' day of ' 192 of said J. T. Ervin, as provided in his will. Received of J. A. Hartness, ©. Se C, the sun of 55¢ in full payment of this 29th. day of June 1922, es my distribute of share in the personal estate of said J. 4. Ervin, as pro- S.J. lianess vided in his will, c This day of 192 Pye eses t Received of *hos, 0. Ervin, Administrator of J. 1. Ervin, deceased the oe er = sum of $17.52 in full payment of my distribute of share in the prsonal est te Received of J. A. Hartness, C. S. C. the sum of 55¢ in full payment of my distribute of shave in the personal estate of said J. 4. urvin, as proe of said J. T. Ervin, as provided in his will, vided in his will, se i This day of 192 ne this 30th. day of vune 1922, “Mary G. Srantley ae OY ee — wt sbi ieceived of Thos, 0- Ervin, Administrator of J+ T. Ervin, deceased the Received of J, A, Hartness, C, 5. C_ the = at ner in ooee payment of he pers 1 estate of said J. T. Ervin, as proe my distribute of Share in the. personal te > t sum of 917.32 in full payment of my distribute of share in the personal estate vided in his will, of said J» T, Ervin, as provided in his will, This ‘ day of 192 AOL , a~\ ee er mine ame Mis ord. dey of July 1922, a. Se - 4 - Or ANAE™m Received of J. A. Hartness, ©, S- C, the sum of 56¢ in full payment of / Py) my distribute of share in the personal estate of said Je T. 4rvin, as pro bf Lbs vided in his will. ‘the undersigned executor herewith pays into the court the sum of ~5Q900" ~" 7676 This day of 192.1 aes 5 a ee a eeenenermeneel iwe—innie—Lt ts the same having been willed, under the will of J. T. Ervin to his daughter Angeline “esbit, the said Angeline “esbit being now deceased, said sum is to Received of J. A. Hartness, C. S» C+ the sum of 56¢ in full payment of my distribute of share in the prsonal estate of said J. T. Ervin, os pro- vided in his will, ; wale: eg of ae lesz —onLih—leyres — 5 ’ be distributed by the Yourt as follows: lipg, Illa Overcash, Troutman, N-C- L. M. Nesbit, Troutman, N.C. { G° the sum of 5%¢ in full payment of se z | R . A, Hartness, C, 5. aes R. T. Nesbit, Troutman, N.C my acatecnues .e cc aoe in the personal estate of said J. T. Ervin, as pro- 2 ‘ : vided in his will, Everett “esbit, A minor, Troutman, N. Ce ” , ’ ’ ‘This _. wy of UNS Ps ley—Gretnllesetr> lirs, Annie “ills, Statesville, (“1 ‘ lip, Grier “esbit, iinston-Salem Oe of © G Smith, CSC the sum of Seventeen and 32/100 Dollars ; | 1 of amount due me from the estate of J T/Ervin, and Mps, Cenith “aynes, inston--alem, A ta eee tater eeaet of T 0 Ervin, Executor. .: | « 19s. Same “esdit, “ooresville, N.C» | This the llth day of Sept 941 a , ‘ P ha . | a 4 es ‘ " (cuales a situs iia 418 _ pe Received of Thos. 0° Ervin, Administrator of J. T. Ervin, deceased the The above named persons being the children, distributee and hei t &5 + 3 oS DUTC Sy 10d ne1_rs a sum of 317.32 in full pyment of my distribute of share in the prsonal estate law of said Angeline Nesbit of said J. T. Ervin as provided in his will. This July 8th..1922, ™ +} 7 7 922 This 29th. Cay of vune 19 2hs+@ : m Tsar’ He CC, Ervin P.O. Ervin Executor, R Thos, 0. Ervi Administrator of J» T. Ervin, deceased the 5 ei ea a Received of +hos, 0. upvin, or ’ The undersigned executor herewith, also pays into the Court the sum of f ( $17.32 to be paid to A. Yenith Waller, one of the devisees under the will of v sum of $17.32 in full payment of my distribute of share in the prsonal estate of saia J. I. Ervin, as provided in his will. J. IT. Ervin, deceased, This 29th. day of Yune, 1922, This July Sth, 1922. A’ ‘, Coal ‘lice C. Yvoal,. O- Ervin Received of thos. 0. Ervin, Administrator of J« T. Ervin, deceased the sum of 317,352 in full payment of my distribute of share in the personal estate Received of J. A Hartness QO Ce th ee wet 2. om = : 7 " 1 ° * it ee . ie dob 9 ve We he sum of 552 in P11. paym on of of saia J. I. Ervin, as ppovided in his will. my distribute of shave in the prsonal estate of said < re teevin pay Peek did . - wuUulUu ue +e sVAiN, Ss pr 1 his 29t! fd 1922 in his will. +his h. day of vune 19eec S$ 2 y , R. Lew This the day of 192 / 5 iatincsinie acento eae —— —— Neey—Lla Overcase, TD ‘ ice : : ee Received of J. A. Hartness, C. ©. C the sum of 55¢ in full payment of Received of Thos. O- Urvin, -idminis rator of Je ++ “pvin, deceased te : me ¢ oe ° + e my distribute of share in the personal estate of said J, T. Urvin, as proe a ; oe rae . vided in his will, sun of 317,32 in full payment of my distribute of share in the personal estate This the '‘ day of 192 oe ees. < of said 3. 7. Ervin, as provided in his will. or eae a se Received of J. A. Hartness, ©. Se C, the sum of 55¢ in full payment of this 29th, day of eune lvec, - my distribute of share in the personal estate of said J. 4. “rvin, as pro- S. J. laness vided in his will, 6 This day of 192 Pt Fresee t Received of thos. 9. Ervin, Administrator of d+ 1. Ervin, deceased the <£ sum of $17.52 in full payment of my distribute of share in the personal est te of said J. T. Ervin, as provided in his will, Received of J. A. Hartness, C. »- my distribute of shave in vided in his will, the sum of 55¢ in full payment of aX i the personal es id J. tT. irvin, as proe This day of 192 — This 350th. day of Yune 1922, uary G. Brantley cone —_——— ne rt = 2 a hr esis Received of J. A, Hartness, C. S. C, the sum of 56¢ in full payment of my distribute of share in the pers nal eState of said J. T. Ervin, aS proe vided in his will. Received of Thos, 0- Ervin, Administrator of J+ T. Ervin, deceased the sum of $17.32 in full payment of my distribute of share in the personal estate of said J- T, Ervin, as provided in his will, This ' day of 192 AHS BLY , ~ wn wo pon Mis Srd. dey of July 1922, a z Fe - - f Be Received of J. A. Hartness, ©, + C, the sum of 56¢ in full payment of / the my distribute of share in the personal estate of said Je T. Lrvin, as pro- bia C vided in his will. the undersigned executor herewith pays into the court the sum of +5900 This day of 192 sk so r ae Teenie Hs. the same having been willed, under the will of J. T. Ervin to his daughter Angeline Nesbit, the said Angeline “esbit being now deceased, said sum is to be distributed by the Yourt as follows: lipg, Illa Overcash, lroutman, N-C- L. M. Nesbit, Troutman, N.C. R. T. Nesbit, Troutman, N.C> Everett “esbit, A minor, Troutman, N- C+ irs, Annie ills, Statesville, i 1 lip, Grier “esbit, liinston-Salem Mes, Cenith “aynes, «inston--alem, Samuel “esbit, “ooresville, N.C» Received of J. A. Hartness, C. 6. Ce the sum of 56¢ in full payment of my distribute of share in vided in his will. This _ day of Received of J. A. Har my distribute of share in vided in his will. This day of $17.32 same being in full of shown in the settlemen This the llth day the prsonal estate of said J. 1%. Ervin, as pro- ' 192 : "— Mee>—Gonltihleyrres , tness, C, S. C° the sun of sb in full payment of the personal estate of said J. T. Ervin, as pro- 1 je —retn_lieseits ¢ Received of C G Smith, CSC the sum of Seventeen and 32/100 Dollars amount due me from the estate of J T Ervin, and t of T O Ervin, Executor. | of Sept. 1941. | Received of J. A, Hartness, C, 5. C° the sum of 56¢ in full payment of my distribute of share in the personal estate of J. tT. Ervin, as provided in his will, This | day of 192 boven : ' e—emnret Lagi * @AGDCOTEBOGAIIE SAD @e Ke OOK KS ZT AK CS, JAY North Carolina, Iredell County. Tn Re of Thos, 0. Ervin, administrator of urs Io the Hon. J. A. Hartness, C, 5, O- Thos, 0. Ervin, administrator of the estate of lirs, A- ©. Ervin respec- fully returns and shows upon oath that the following is just, fect final account for settlement of his transactions as such administrator: Receipts. Received from First National Bank of Mooresville Cash on hand at death of deceased, lotal receipts, Disbursements, Letters of administration, » 5,85 Advertising sentinel 2400 C. S. C. Inventory e75 i. A. Bristol, attorney fee 2.50 Dr. Yell 22.00 br, Brandon 18,50 Dr. Wilson 5,00 J. Se Wough, funeral expenses 85,00 Barron and Connor, tombstone 55,00 M. P, Alexander, sheriff 56.00 Attorney fee final settlement 10.00 CS. S. C, fina} settlement 4,00 Administrator s commissions on recp, 20.76 Admins, commissions on disbursements Las6o Balance on hand to be paid to distributees 145477 341540 The undersigned Administrator hands herewith receipts from distributees as follo Paid to Alice C. Cook Paid S . dg Mainus Paid M. G, Brantley Paid Sam Ervin Paid H.C. EPVin Paid Ry. lL. Bevin Minnie allter daughter of Cenith Ervin 14,37 nos, 0. Ervin 14°37 Cc. P. Ervin 14.37 the heirs of Angeline Nespi 14.37 143.70 ry Tt O, Ervin Administrator, Sworn to and subscribed before me + ‘ i of July 19 har ,e ihe foregoing final account, inistrator of the estate of “rs, A. ¥, Ervin accompanied by receipts having been care - 4 7} nana } c —< o™ i 3 7 + fully examined and audided by m approved andordered to be recorde ed and filed, This 8th, day of July Hartness bh pb % 4 7476 herewith pays into the court the sum 6f (14,37 to be aid to the following The undersigned administrator of the estate of A. C. Ervin, deceased, a a persons, as the heirs at law of / line Nesb deceased, a daughter of said A. C, Ervin, “ames and addresses of sald persons are as follows: s, Ila Overcash, Troutman M eee Troutman, N routman, ‘ . tesville, nston-valem, ding, Cenith Hay ans tone alen, wag wel Nesbit, | MOOT ine “Ye This July 8th. Received of Thos. 0. Ervin, Administrator of », Ervin, deceased the sum of $14.57 being in full payment of my distribute of share in the personal estate of said As ¥. rvin, deceased, this 30th, day of June 1922, senceaeran Site San OSS Received of Thos. ‘ Ervin, Administrator Of As Ervin, deceased the sum of 14.37 being in full payment of my distribute of share in the personal estate of said A. C, Ervin, deceased, This 30th, day of June 1922, ery 4, Brantley Received of Thos, 0. Ervin, Administrator of A. ©, Ervin, deceased the Received of J, A, Hartness, C, S. C, the sum of $1.59 being in full e We © 44 eli ‘ + LI z n u pay- sun of 014.37 being in full payment of my distribute of share in the personal ment of my distribute of share in the personal estate of said Ae C, Ervin, estate of said A. C, Ervin, deceased, deceased, This 3rd. day of July 1922. This day of 1922, S. E. Ervin es Received of Thos. 9. Ervin, Administrator of A. C, Ervin, deceased the F Received of J. A. Hartness, C, S. CGC the sw ‘ sun of °14.37 being in full payment of my distribute of share in the personal . SS, Ve oe ¥, the sum of “1,59 being in full pay- ment of my distributive share in the personal estate of said A. C, Ervin, Sa estate of said A. C. Ervin, deceased, deceased, This 4th, day of July 1922, P. Ervin cece aa tet CL CT tt Ce This day of ___1922, Received of Thos, 0. Ervin, ‘Administrator of A. C. Ervin, deceased the a . 2Yy (4 $ » fo 9) ha a \f* mir $a a4 Wait ¢ han In +} a 5 n 1? : rn um of °14,37 beings in full payment of my distribute of share in the personal received of J. A. Hartness, C. 5, C. the sum of 1,59 being in fullpay- c . on s (* > . Ac ac A d s “ee 4 24 estate of said A. &. Ervin, deceased, ment of my distributive share in the personal estate of au said A. G. Ervin, ihis 8th. day of July 1922, deceased, ne Oe Ervin This day of Received of Thos. 9. Ervin, Administrator of / C, Ervin deceased the inact cessed etn a aha sum of «14.37 being in full payment of my distribute of share in the personal so eee Received of J. ‘\. Harness, C. S. C. the sum of {1,60 being in full pay- estate of said A. ©. Ervin, deceased, ment of my distributive share in the personal estate of said A. ©. Ervin, ihis 29th. day of June 1922, deceased, H. CC, Ervin —-— a es this ss ty of ee ee Received of Thos, 0, Ervin, administra:or of 4. C. Ervin, deceased the sun of 514,37 being in full payment of my distribute of share in the prsonal Received of J. A. Hartness, C, 5°C, the sum of v1.60 being in full pay- estate of said . U,. Ervin, deceased, ment of my distributive share i" the ersonal estate of said Ae C. Rrvin, ‘ Alice C., Cook Deceased, is : +his a Refeived of “nos, 0.Ervin, administrator of A, C. Ervin, deceased the ee sun of 514.37 in full payment of my distribute of share in the prsonal estate is Sat of said A.C. Ervin, deceased, Received of J. A. Hartness, C. &. C, the sum of #1,60 being in full pay This 20th. day of June 1922, ment of my distributive share in the personal estate of said A. C, Epvin, Re Le Ervin deceased, Received of “nos. 0. Ervin, Administrator of A+ C. Ervin, deceased the rhis day of sum of (14.37 heing in full payment of my distribute of share in tne personal estate of said A. ©. Ervin, deceased, : Received of J. A. Hartness, C, 5. CO. the sum of 1.60 being in full pay Mhis 29th. day of June,1922 I ay “se ment of my distributive share in the personal estate of said A. C. Ervin, Minnie \/aller deceased, shis cae wages i Cc. S sum of 1.60 being in full pay- Received of J. A. Hartness, ©. »» C, dhe ee iin, h. C. Ervin, de~ shear the personal estate of said A. {stributive share in Pp te ne ment of my da ceased, ae the mat*er of Wi. L, Neely ) . 2 administrator of the estate of ) Final A Tt ee Me C, Neely, deceased, ) oneares To Hon, de A, Hartness, C.:. S.. Ge We L. Neely, administrator of the estate of 11.C, Neely respectfully re- %e Lv qd of T } tn Ss C *) um of 34 60 beings in fu l vpaye- nd shows upon oath the ? l l ny 4 z as a u] l ’ true and perfect fi al ce’ ec ve A. 1ar or ess ft C ee . bne sur ‘(me meaeS z yi ° OV ng a | C > e . his transactions as such administr t A. Ss toy V in a oe ettlement of share in the personal estate of said ; > uv distributive s ment of my ; ee aeneed. Cash on hand in bank » 134,23 nie day of ; his ___ Gay snsciiiniia Collected on certificate of deposit 200.00 S old 1317 lb.s of cotton for 513,635 vollected interest on bond 10,63 Feb, 2nd, 1922, sold cotton 162.50 April 20th, 1922 kold cotton 65.17 May 6th, 1922 sold corn 41.60 Collected interest on bond Sold W. Le Gilbert one third Liberty Loan bond including accured interest from March 15th, Sold Park Goodman, cotton Disbursements, July 15th, 1919 paid lliss Bertha Stevenson w 125,00 trained nurse, Letters of administration, 6.15 Paid C, Lt, Beaver 13,00 Paid Dr, M. R, Adams, 46,00 Paid J, H. Krider, Sheriff of Rowan county tax 1919 26.62 Statesville Durg Co, 17,54 J. W. Nicholson Co, 218,50 Paid J. H. Krider, Sheriff of Rowan VYounty dredge tax 76.28 Paid City of Statesville Cemetary lot 90,00 Pa, Landmark Aev, Administrator's notice 2.50 Pd, J, H. Kreider, Sheriff of Rowan County tax 1920 47.49 Pa, J. H. Kedtier, Sheriff of Rowan County dredge tax 73,89 Pa, J. H. Kreider, - fae " tax 1921 64,25 Pd, J, H. Krider, . re ” dredge tax 70,08 Pad, W. Le Gilbert for three years board, for Mrs, ©, M, McNeely at $14.15 a month, farm Pd, W. L. Neely expenses for making trips to the fa in looking oetar crops and in making trips to Char« lotte and Asheville. 509,48 44,14 426 Paid W. A. Bristol, attorney fee ¥ 125,00 Total disbursements ™ vieeeeeo Paid J. A. Hartness, C. Se C, final settlement 8,25 Paid W. L. Ne@&y 5% commission on total receipts 84,10 Paid W. L. Neely 5% commission on disbursements 77.79 Total disbursements aii ore Estate due W, L. Neely the sum of $3.58 This July 2lst, 1922, We. Le Neely ADWinistrator. The above named: administrator respectfully shows the court that under the will of .C, Neely deceased, filed and registered in the Register's Office of Iredell, in Book 8, he turned over to the following devisees, to wit: Mrs, A, Lawrance, lirs, Fannie Gilbert and W. L. Neely a certain note executed by H. R.Cowles,. Gaid administrator further shows to the court that he turned over to the distributces of tne said l.°, Neely ‘certain houshold furniture and fixtures by agreement entered into by the devisees and according to the edpressed desires of said li, ©, Neely, deceased, W . L © N eely Administrator . Subscribed and sworn to before me, this 2lst day, July 1922, J. i, Sharpe ae Dept. “lerk Superior Yourt, The forogoing final account of \/, L. Neely, administrator of the estate of M. C, Neely, deceased, accompanied by hits vouchers supporting the same have been cxarefully examined and audited by me is hereby approved and ordered to be recorded and filed, This the 2lst day of July 1922, Jd. A, Hartness Clerk Superior Vourt, OC COCOCO CO ECOECE® 2) C@QQOCOOEOVEEGLEZOOQOBOQ. C. M. Steele, executor of J, c. Steele in final settlement made this the 28th, Received of Com. N. Bank July 16, 1922 " Yount Motor Co, " U. S. Bond Coupons Oct, 15, 1922 " Imp. F, M'fg' Dividend Oct. 1,1922 Coupons U. S&S. Bonds "w J. C. Steele & Sons a/c Dec. 20.1022. " " " " " 61,1922 ” Superior Yarn liill dividend Imp. ¥. M'fg' Co. Dividend Com. stock w " " " " " P. Stock Jan.1,1922 " From sale U. &. Bond april 16,1922 From Imperial M'fg' Co. July 1,1922 From sale & shares P. Stock, Imp. f#. 427 day of July, 1922, ; Assets, ¥ 904.77 23.50 10.62 “4.00 51.88 650. 00 150.00 140.00 24.00 7.50 611.59 17.50 From J. C. Steele & Sons a/c July 26 '£2 1500.00 M'fg' Co., July 21,1922 502.90 e Balance J. C. Steele & Sons 8/c 1,277.20 @ 6,485.26 Credit tor Vouchers: No. 1 J. a. Hartness, C. os. Ce. aug. 1,1922 # » 7.45 No. 2 Baerim Building #und Aug. 29,1921 20.00 No. 3 W. T. Nicholson Buriel Exp.Aug. 11,1922 568,00 No. 4 Mr. Annie McK Steele, Equitable rent 6/2/2z 110.00 No. 5 Sumder Grocery Bills Aug. 1,1921 20.58 No. 6 Thelma Fraley a/c at Mitchell College 3/26/22 119.25 No. 7 Mra. Steele, (Dividend) Nov. 1, 1922 24.00 No. 8 Barron & Conner, Lettering M. Slab,11/1/22 14.00 No. 9 Presbyterian Educationel Fund Subscrpt. 300.00 No.10 Mrs. W. A. Eliagson a/c Jan. 15.1922 15.50 No. 11 J. —. Brady a/c Dec. 16,1922 155.00 No. 12 City of Statesville Dec. 20,1921 91.71 No. 18 M. P, Alexander, County Tax Dec.20,1921 56.86 No. 14 M. R. Adams, M. D. 4411 Jan.7,1922 4.00 July 26,1922 200.00 No. 16 W. D. Turner, Atty. ee &ccount with said estate h ‘ i ¢ North Carolina, No. 16. Mr. E. R. Rankin, Inheritance Tax. § 129.50 th Gis Saseieie Goud: No. 17 C. M. Steele " 41,23 Iredell County Before the Clerk. os " oo 46.12 In the matter of B. L. Siggers, | a a administrator cf B. D. Graham No. 19 P. Steele 36.13 Dece..sed. oo No.20 F. Steele E 40.6 ma | | To Honorable J. a. Hartness, Clerk of the superior Court of Ire- e ounty, N.C., your administrator heretofore avpointed in the :bove te. 2p : He Rickert & Son a/c 12/50 entitl dad hé +1 > a : mie + J 1 ed matter, begs leave to rile his final settlement of said estate No. <3 4. Hartness C. S. C- 15.00 as follows to-wit: 2s 6 e 97eII8e 7 © , * August 10,1921, first National Bank, Statesville i ogee money of deposit subject to check G . - august 17th, 1921, Salary check from Brown-Rogers 5% Coms. on y2,062.07 102.85 2,459.18 Statesville, 7.6. z OWl-.OfeCTS § 3,046.0 % ’ 08 august 2Oth, Certificate of Deposit, F. Statesville, N.c. Special Vouchers: Item 4. wl ae i ; august 2érd, 1921 Returned fire Insurance oremium Virginia Steele receipt $200.00 C. Mi. Steele tor Sylvia Steele 200.00 total receipts. (815.57 H. ©. Steele father for Rosa Steele 200.00 Building and Loan shares yet in sand. 161.48 Steele father for Lila Leins £.: 200.00 Interest on certificate OL veposit & B A ] 6.46 " " "a, P. Steele, Jr 200.00 wl00e be Steele " "Bleke F. Steele,dr. 200.00 $ 1,200.00 TIM Va Nn ’ me wpwuer : ocee me i Sees OSLATEMENT OF DISBURSEMENTS OF B. L. BIGGENS saDMR. CK D. B. GRAHAM ED AA DSN Sho td ad @ 11 j } ¥ 846.08 ° To be divided under item/of will $1, be ee eS havtines. 0. 8. ¢ i r a ’ te C. M. Steeles’ part $369.21 2/5 htm, 12. been - dD. 3, Kimvall 6.56 Re tained 369.21 3/5 Lug. 11, 1921 Postal Telegraoh Co., 2.94 ». & 's pe 4369.21 & | . i. 0. Sonne 'e OP" ee Sie auge ll, 1921 Iredell Telepnone Co. By eneck July 27, 1922 9369.01 iay age) di C. slexander & Dro., I. P. steele's part $369.22 - 1 a ees ee By check July 27,1922, $369.22 18, 1921 Dr. Ross licilwee F. fF. Steele's part $369.22 L921 Jonnson-liiller #une: al By check July 27,1922 $369.22 1921 = Statesville Drug Co. E. k. nankin's part $369.22 aug 1921 - Yount lotor Co. By chnetk July 27,1922 $569.22 1921 = Home B. & .L. association 1921 - G. A. Critcher wT! nn > ly Mrs. E. R. Rankin, , 19z21l- B. H. adams ’ , Ge ¢ To balance after paying inheritance tax $22.50 22. 1921. - Holland Bros. By eheck in full, July 27,1922 y22.50 © 1921 - B. A. Cowan ees the I have turned over to the several legatees and devis aug. 23, 1921 - J. C. alexander & Bro., >2 ce ” 4, 5 property and stock specifically will as directed in Item l, 2, %, ’ Aug. 22, 1921 - City of ‘tatesville 6,7, 8, 9, 10, and 11 of te tators will. Sept. 3. 1921 United Cash Store Co., . a» = C. M. Stecle : “Executor of J. C. Steele | Cct., 15, 1921 - The:.Landmark Subscribed and sworn to before me, this July 27th,19<2. Dept. t S e as. c. SRGeCSGRRRes bec. 29, 1921 = City of otatesville Audited and 4 ed. North Carolina, } - Me. Pe. slexander 515.73 ~— : Iredell County. | J. &. Efird monument 405.00 In the matter of Jay “art { PARTIAL SETTLEMENT Administrator of George “art, | oe March 6, 19.2 C. sanford 50.00 Total 872-84 Total Receipts #1003, 83 CHARGES: Total Disbursements 4872.84 . : Nov. 23, 1920 To sale of personal property coanne Balance on hands of udministrator $130.99 ee CREDIT BY THE FOLLOWING VOUCHERS; inis balance of $140.99 has been turned over and delivered to B. LD. Graham and urs. B. L. ®iggers, all tne only heirs at lew and J.M,Arey, Clerk at sale ue ‘ : jdow of the said B. L. Granam, aecexsede J.M.,Arey, Chattel mortgage B. L. biggers WeC,Perry, Auctioneer sale oamrelD. B. Graham, Lece:sed. W.T,Nicholson & Co,, undertakers . . mS 1 ye PR Q 9 Granam dece.sed, being duly sworn J.T, Stikeleather, Balance of mortgage @ true an ecurate account of J,A,Hartness, costs this settlement AaUY rraham, aececsed. JeA,Seott, we. Atty, The Administrator remits conmissions J. We Sharpe —- in excess of ve pt * Total receipts fone foregoing final settlement of Be. u. bigeers, uadmr. of Jay Hart ‘ranem nas been audited end examined b, me end tne same 1 A reby in all ‘ Ms ‘dministrator of Ceorge Mart. sspeets avproved and tne said B. L. Bigsers is nereby relewsed as udmr. : Sworn to and subscribed before me, 3, D. Graham, and the foregoing settlement is nereby i all respects ; ’ ; y this Augusb 14th,, 1922, up roved und accepted. his tne 30th. day of ad f J,eW.Sharpe Dept. C.5.C, J. o Hartness ae oe Audited, approved and ordered filed, J,A,Hartness, C,5.C. ia t op e r em e r Horse kitchen furniture. 3% 176,00 £5.00 rovigions on nand - 16 bu. wneat 60,00 rowing crcps 172. O06 e Vs 475.00 4a Ss o Carrie inal settlement f Mrs. Elizabeth . ‘ + ‘ + y+ Cece. Sé m Nis 140Ne. G&ay CL Credits. Sredited by following voucners: No. 1. July 20, 1921, «,rst National bank note « Hartness, 5.85 Lazenby years eéllow. « 50 august 6 Nat. Bank note 75.00 No. 5. duly 21, 1921. Statesville Drug. Co. acct. 3-78 NOs 6. sauge 1’, 1921. Kelly Clotndéng Co. 2/60 7, auge 20, 1921. Ramsey Bowles More UOs acct. 387.72 No. 8 lO Q > © % 190 4 Oe ~UR oo, L¥cle BREXYTIl) No.10 .aug.25, 1921. BOsh Vode YY . . + No.el2. HURKe KS, LICL. 13. Aug.25,19 Mod leaves the estate ye 76 ‘g. Blizabeth beitz first ng dul; vorn, eooses and says that + tne foregoing is u true and cet statement and account of the final settlement of the estate of i beitz, decd., showing the amounts that came into her nands 4S administratrix of seid estate, or into the nands of any other person for her, and how the same nas been dis- ormation and belief. bursed to the best of her knowledge, in Mre, Blizabeth a». Deitz, «dmrx.s 434 i July 19,1921.C. D.. Moor Rh Sworn to und subscribed before me, | = 28.76 a this 14 day of Sept. 19£2. eee 8, 208k, DFS Us. 0; Gideon i Aue. 26, 1921, ¢. ahi J. o Hartness = : ’ Vet, 16, 1921. nealty Liv. | i Je We Ve Yee YOULL 53. : Cire 7a 10 7 > | ; Oat. Lv, LYZLe nealty , Inv | i ° Uv. GO, i race, - i i . : 5 14 3 sina «di a 1 axr £ ao xt mh yO { r Qo * oe } Bxamined, audited and approved, this day of september, 19<2. Nov. 50,1921. Realty & Inv. Co. ‘ ne 60.1 ; Jd. Ae Hartness Nov. £0,1921. Tax : ; JLOLEK 0 per ior COUT. 254, - | feo. &, 1922. Payne ie t . mn ati ke —— = . < ui LL € < : Ve ee ee ct : ee: & ® we & t ; ote f I we ‘ok ee es es Cil Co. - - J F c a a vUly shy Lvaotle 2G UCL UL i 4iU CS I ; oa > AL UWUe é - . i warY ise UOWGll, KBaMinistratrix cr tne wstlarve Vi ; a20OUNT GuUue te ode lkills { - ny 7H 7 oe ~ 4 ~ } 2a7~ ie @ii4Q ELVEI1 D z EC yt | 1 * « - -~« “*e ~ Ali { i. + 4 + 2 . é on 4 4 ‘ r ; 5 > a ) ye o 2) i Bl do lbp VOWaN, 2 tinal ettlement itn s@ia ssterte. 1 7 ‘ LO ee . sea (Re \ / 5 Yrrc 37 —— L +e . su. ad 4 n ” = . ' 1 UY i + + wr 4 4* ' ’ © + - 7 gO Uli U &% J LC z . , \ / ~ ] . a. } ny é \S euliG be», h a si Via ass 14. = O T 1 7 e ssi 44a ai U 4 r + F C Lal e LOW&an, me sin a " + "2 4 Te949 . » ] » m a q eulle wt g i vue sv L 3 4i Wi we A Us eea ive “ BiNCuULt GUE © La e riod a t : é “3 _ i a vist dO GWiIQ 4 z se VOWG 7 , e _ ° ‘ a a y | 4 e Ull deg LVvLe Gaic © Uli ie eV 1 eULY co ] f + + ~.) ~ a Hbubse Ge &o Oat : / © Vm, . ave L we « oy 4 on ~~ a ) { eUl ew © xg as sv Oil LUL . « ~ Ne] swHele LO ,-LISGew LEaETESV 1 4 } rence j TED > : ve Us, “» Lv nvr e Lido UL ALsUS syuks UWVAS iti & ailtse . Sap 2 4 +n st 1} tan ¢ 7 \¢ fas ) eUuLy 7 LY9zL. Vividena,otetlesViliic sYOceTY Ue OVe VU t ! en e nr ee ee r sept. 24, 19cl. Sefund, stutesville noel “Oe 100.900 Bal. due for distributic 12.4% ; . tooer “> Ly Jd @ VAIViIae : v te Vase rOe sOe OVe dU { : ‘ Le i + 1 Sap 4 ; mPotaany: 47 an f 0) elle Uy LJnve YWLV LUC, ,LEUVES VLLLG Ti Vo 106 VUe VY j 4 j + + . + _— +/e Ul tJN1lsSs ahoune 4G suiil, ° a vied | i ville Wy LYEle 1Viagernd, w1,cCH Lace - ing Ue (0.U0 | ' q | reaiteda : or Tecelpte ‘ “74 4 - + ‘ - Le 0 elle wy LVYehe VIVIAE ’ ee v WUIOIGL ALLA we\ . ss490 + - i e/fe Vs A ok eBmount AG a . i v 4 i j i VOEOLUG UL IOTSOMWL ro erty not reduced tc casn OVVVe JU { | | “ 4 i‘ 4 ~~ ¢ + j sc SU OY ef FecYel ve ED a a | 1 1 r e ; 5 a i ‘ ~ + + ~ \ Lotal 10,691 206 Tne estate ad t C owi rso..al C t 3 tu7 i ae ’ ° . 4 Aimee se . ers tye . :+ ‘ Cver to distributees, ne istributee sdvancing Tuas it ( tc ' j \ T Ys ; H ‘ wee ‘ee ee Ye f | -Omnlad4 eS. ee . ; a complete settlement: / ’ June 17, 1921. Buren Jurney, Notery see ©1.00 | | VOWS % LUUe UYU Hi } ‘ June <4, 1¥Ycl, Nursin; a2. 10.00 automobile 400.00 June 00, lyzl. City of statesville street ussessment 2650.0c Ct.er property 400,00 | June 20, 1921. City of stetesville vem. Stocks and bonds 7600.00 lot YJ). 00 Pte potal 8500.00 July 6, lycl. lezenby Mout. UWae Uo 6.00 : : e , Sowan and anna hobinson vowan. uly 6, 1921 {. Nicnolso: Co. fun- Credited by receipts of Mary ™% e J , - . ‘te e ay hav 4h we . u eral expenses 259.00 Respectfully submitted Vary L. Cowan. s.dministree sworn to and subscribed to sud Lt »U this tne L4TNe Noxrta WUrOLLila, abe 4U unity . tne 14th. ay J. +. Hartness Clerk superior Court. nouse on game Ll-z6-c£1 Lot s:ace treet Ll-2£6-c21 4th. & Sthe SVe Ll-2£68i1 f ) re ‘ “CP « otal churges OT ‘ w LUUU ), VO 2216.66 46400 4VU < O9-. 60 ry I 58.75 ~ 1100.00 43% O ed 22354.26 VITED BY , Cedae il rtness, eV, 16T fone ris . ; ne lLwudmark, notice to creditorg VOC. bes 19138. ste mortgages Int. on 4.urs. u.C.Watts, note Int. on the same to Jan.14. L91¢.S. nt. on same to vane l e+ Y14 es mt. on same vune 1,191¢. W. Int. on same to pril Ds Lvliéd. int. on note. inte On ame tec UCTe £0, 1915. l7ite ON same t » } " Olle Ky, VET s Ge int. Ol same tc tT waticocnal sank Sy LILOs ee te Nicene LSOlM ral expense 165.50 on tne same 1 @} 19,12 4. 5s. Jd. Holland livery stable £6.00 on same to settlement 16.20 15, 1914. br. M. hk. adams, accow t 195.00 on the same to settlement 91. v6 25, 1915. idcleel Wurble Co. #00600 1or SF 120.67 Int. on game to settlement ak re ‘ : sn eye 944,00 Wwrs. Bertha vomers, nurse J44 o\ r v's fees 625.00 \. B. McLaughlin, atty’s te april 15, 1915. Mra. Bertha somers, note 1000.00 ' 56,82 Int. on the game to settlement rs Nov. 21, 1918. G. H. Wood, note oo be 8 Int. on the same to settlement ae aT 1916. MEW ° Int. 6, LYskee amount in fithian,note 2600.00 on same to settlement ; mes ue YOK ete Hartneus, C. settlement hisgion on receipts ota YU% « fo my cém:ission on aisburse-~ to ye6490.c21. 1324, 4U0 6 GUT .e PeOLMLI he balance surr le e . naa4 wy UASCULT 1F be rece ve me Hartnesvs Clerk superior Court. ra@a tee a erecta tees amounts received by administrator July 6 1920. amount of Dank » AOusge r rA®) ed YZ0. 4, 1920, bullard, sAOWTENCE 14 aveV [3 O88 Y SL, LOE - Ballara, pepte 4 dJdedp Lowrance ” U,1920. LOWYan 18, LLOnN BOeeu LITO 40,1920, Jo. Ballard, house 20, 1920. de ke. Ballard, house UOWLUNCE, » 292Le LYELL. Be Lu2l. de 1921. BGe LIKZe hehe y vebocr 21. 1921. JK. Ball 22, 1921. KB. Jdolionus, house rent 27. 1921. Ce Ke Kinmer, nouse rent 4, 1921. Richard Clarke, eotton rent 19. 1921. Oe Ho K4m Or, nouse rent re 2, Be Webber, balance on rent 22, 1921. B. Je hows, house rent 921. de Re Ballard, nouse rent j21. Be JeKhoas, house rent RE Tg ES 26th, 192 ww ur Mitchell, house rent pre . ° May 18, 1921. C. R. Rimmer, house rent rf 21, 1921. J. Ke Ballard, house rent " 26, 1921. B. J. Ross, house rent June 7, 1921. J. B. Edwerds, house rent ’ 21. 1921. C. Re Rimmer, house rent " 26, 1921. B. Jd. Ross, house rent : . ? J. B. Edwards, house rent July 56, 1921. B. J. Koss, house rent * 8, 1921. de . Hdwards, house rent q 20, 1921. C. R. Bimmer, house rent e eo, lycl. J. Kk. Ballard, house rent uge 5, lycl. Bb. J. Koss, house rent . te, Leeke Oo. Re Rimmer, * : 27, 19245 0. Re Ballard, ” " 2Y. 1921. J. Be. Edwards, ” Sept. 5, 1921. B. dp Koss, house rent ' by SUohe We te 9 r, house rent ” ot, Lucie We Re 38 llard, is " " " 7 , " ve s/@ ‘ vi were we Oct. 6, 1921. B. J. Ross, house rent : 7 A. Jd. Hartness, refund on i " ae, 1. J. Be. Edwards, house rent o Li, Lvels Us Re oe n - Me, A9eke Ce Re BBLIATA, WOVe OO, Ll9eLe e Ve OSB, * le, 1921. Jd. B. Bdwards, a : L, i9eis Ceo Re a er, " " , ’ City j tatesvi Lae. re Be ;1LAdewes . ” 25, 1921. Je Re Ballard, house rent eo. 6, 4d - Be Je KOSS, house rent 7 L7?, 1921. C. i. Rammer, house rent - a ee Jd. Be. Edwards, house rent Jan. 5, 1922. BM. R. Ballard, house rent Jan. 6, 1lY¥ze. Be de Koss, house rent 7, 19c2. J: B. tdwardas, house rent ™ 24, lY¥ee2. de Re Bullard, nousge rent " 60 1922..'C. Re. Rimmer, house rent Feb. 7, 1921. B. J. Koss, house rent " 11,1922. J. B. Edwards, house rent 15.00 17.00 15.00 9.00 15.00 favo LDd~e OO 15.00 17.00 hse O JeVU 1S. 18) 9.900 D6 QO 56.61 10 L921, Si ae ee " 26 And ; hes 19 we ve . ii 5 " ¢ 9 sii To ahs LJithe We e " " " /@ . 4 4 " ig Lviive we . at a ple &, hehe Le Ce " ‘ 7 @, 1922. J. B. Hawa Ww ’ 47. 1922. J. Me Pa " } ‘ \g 49, 2928, C SOWa " d } ‘ a} h . 4¢ vce - ea } l . ahem) sy + ive ve . r 5 } J airy Lo, a J tw hee . Ve , "” " . 1 Ci " l + + Io dee fe Ve dhe LULL '" , 1oes MS, bihibme We . ~ 7¢une < ’ k= foe s Aide " 1 CO, do J bus ba @ © ve \ , ' F 1 L656, 2922. 2. " a. TER, ds Re Be VULY 1, LIh&eo shi tais oe 4 ' . L4 iYgz * ’ A J hahoe . we pe >» " a * + ~ evive ve + 7 " Sy we Ve . & tr tw 9 ‘ve . t . ' t / . ‘ 4 . , LJ hehe Ve . ? , ° a. - ce , i ‘* te . ‘ 4 CGC Onl ni ( ‘a t 7 : ( 4 , Ollt ] ) fl ° ‘ A i . C ent p. es A i " 4 ‘y cts 4 i ' Wy ° . 7 ¢ - . ° : ay A 1 A 4 a i ° A is iv fe Ieee Bie | enent « f ; ‘ } . ( { t . }e 1 . it : ‘ fi t : ° ! . + . , . ’ . of 4 4 ‘ e fe 4 \ . ” * ° | ° b | 4 i ° i ” 1 4 4 e e pif J °. . . Vv is9 Vo Disbursements ‘ 2», Eagle, administrator of Nl. r. July 8, 1920. Jlaywell Bros. for casket Clerks fees & administration papers water dept... ldw. Co. sningles Brown, fertilizer istead aitcnoz Nicnolson snarlotte vtatesvil b’al. on taxes -lexander June 27, 1921. J. «uw. Hartness, Inheritance tax duly 14, 1l¥cl. \ ,» luunday, plumbing repairs 26, lycl. City water dept. 2, 1yv22. Thomas ! Co., piping &e@ VU £240 22 6€ 6.06 0206 4.08 40.07 1.87 179.86 4.40 2.56 6.50 Oct 14, 1921. vity of statesviile, Sidwalk,. iov. 8.1921. tagle & liilholla) ~ WSS 9 " 28 Lek jiey OL J lyzl. Thomas veUNe Ld, sworn to and subscribed before this llth. day of Sept. 1922. 4. L. Lowrance Dept. clerk os. Court. CECE CGE dee CRBC CCECOGEBRE eo s di i e k ee er s Ud 4 oO ue 4d = ; . m : 2 ° > rd 2 i al o : > : > > : ) tO ) 2 i ; ‘ ; ‘ 7 " . * . - . . : aq “i p +? s 7 * . . = = > i / > rd 4 j + i - en 4 . 5 rt : 2 ~~ . - a 7 ) - - « * ; $s . af > ? cc =i ¢ - - ~ 4 - ; e ’ 3 °) ~~ ® * “) ; ri } : ct > ; , ‘ 2 ’ 4 > 2 : + * ws - - R al 2 i : ; ct ° mh j ; 1 ra 5 ; ; o ‘ ; > i ‘ ° z at l ) ’ ; a 4 : 5 Z -) ; . ‘ 4 ‘ ; ° . . , oe > - < 5 . 4 > +? + et ) ; 1 : et + i * ) 2 2 5 ; ; . . i ® ) 2 ® ; f : 2 _ : 7 4 7 . y 7 QW /, 4 : - ° 42 > . { > 2 . 2 + « f a = i 4 4 2 > , ; > . . i ; : = = 4 2 ~ ; . : - > . i ) 1 a ; " ‘ ‘ ; > + ‘ 5 | ‘ © ~ e , 4 ; 3 + . ‘ 4 ff % 4 4 - = : ) Q ) ) ' y ¥ 4 2 }2 ¢ > ‘ 4, 4 > al ¢ ’ Di ; ‘ - 5 ) 2 , ) ti e r ; > 4 ; ii o ‘ ’ 4 > : v ) = OO - =~ © x 2 - 7 ae jo ” * . 2 ~ 2 —~ Oo t N oO D> = Od ~) “ | . r4 2 . > > j @ on . } fe 1 { . a —4 © mn : 3 © | ? : 4 . > ad 4 / Sd > “ 4 : JY 2 : . * . oe . D > : ; . © 4 ed ©) ? J oS fa 3 $4 ) ot 4 L ws > r . + 2 4 stm J LMA LAL 767.71¢ ire » 1] QC 2h res, ay on, par S t eTrrec | ~ a Le state: ae 7? v iills per a VGOle & ville s#lour ar vale % 100 per ww to Cn Saare stock, 264 . 70 10,000.00 10,000.00 19,000.00 17 4 0 0. OO & . 500-6 00 Os eleler 00 i m 4 i a 1 1 1 fertilizer drag pen corn pdanter fertilizer distributor auto tank feed cutter ud ~? “ 2 ) “ luorrison . wae wood 1 } ews 4.0¢ se y Ads v auto 4£n1re \ edi e W Vic wiv nena LUliec os +? DLUCAD: eid ® 4 4 o O 3 ) “ 4 m > D + = 5 3 o n 4 r y a ‘ “ 5 , 4 * ew @) +4 m4 +? ? Oo evO -CTreai wh ds bé Oc © . . © ~ = + 4 ‘ . . 3 2 2 " <9 + ) } >) oo t ¥ ry » ef © - : p> Q) ~ mM ry Viv aiw QO ld t 7 SS MALS Oo ne team \ ( Gal febe ssite - ) oH oH + 4 4 + > 4 ~ ») > | | { « MO } e » ) M ji e 1c ) ) . el «| ® ap a mo . . } 4 2 M 3 ‘ > re “4 ia 3 ai l ) + *) { > 2 co > > ~ 4 H ~ ) 4 { aa D> ‘ + D D ‘ ‘ 4 ed ) 4 - . 4 mf od { Q ~ M4 > A Vuncr Vs ~ “4 16 hee 1 Ue LOO. JU w UL i netic Lice moe MUCL c acres nar re Ve ve pt. cm © uc © . * 4 ce tH > ~ - ) , ; 4 4 : a 3 + r ~4 3 = ~ ~~ MM j 5 > . Ww rro SAG ns C , 2 av arrow } Aa Disc tor ultiva a UG Old - " Inventory of the property belonging to the Estate of lirs. ‘se De. rharr, note and interes ston, deceased. ’ i interest 2®RSONAT, PROPRER® ] PZRS ONaL PROPERTY é C LOUpcCNsS bonds savings account y 166.68 Mill lsvidends ete ) 7 er f . gension 50.00 , seb. le J. He. Mclelland note and int. Cotton Mill note 600.00 June 1. S. J. Brawley. on note 7? +4 4V UO Total 4, 816.68 July 1. Dividend The above is an accurate stuteménnt of the property belonging to July <5. dale the estate of iirs. Jd. *. Johnston, veceused. S. 3. ust i. 19 shee 1006 Tt Brown > | 26. 2uSNn administrator. 42 U? Sona Coupol CB AU 12 Pe - —_- , ° r ‘ . 7 a | + . . “5° theo e REPORT OF L. Cochrane of Floral City , #1&. 4s administra= ig : . ; , a Y eee ZO. B. Me licNeely ,vault tor of the estute of rs. Wary L. Cochrane, “ec a ot idooresville, Iredell County, Nortn Carolina, in iui ane final settlement of : L7.Bank suid estute. nec'd from estate ‘erred cotton mill stock pur value %100=4,300.00 : 2 Nove 1 sold 175.00 | igve14.locresviile snares preferred WOV KO. J snare conu.on ——o 506.00 D1 50 474,50 474,00 —— Qn ‘ 42YO*e ne Le C. Cockrane, sadmr. Floral City, ila. oWOe-Oo Box 261. n hes " 418041 ! Ves ot November tne Sti LOcke AO uO ‘ a Q v CSCERRE YS ee EGCEECES UE annual settlement ot urs. Mary H. Templeton, administratrix. 1921 Receipts . ' pts eh EY te He Ghd GEEGEEGE Ch culy 18. Cash on nand $743.00 septe 2 vale of furniture 42.57 INVENTORY OF J. A. Black's sstate. " 17. Ballard note 1100.00 10444, 00 & @ 428.00 land © $28! 50.00 Oct. 5 Kefund R. nh. Ticket 71.64 ars i bucay » Zs } . . a j 5C Dec. 29. Bond coupons 6.37 Household goods 150,00 House & Lot 2500.00 sworn to before Cash 1688,00 wo 7 Z Ko » 00 * IWKe Liabilities. 1000.00 r accounts réayadle % L5& 22.00 21Hn alk os diLe 1) eA DK administrator. let ez Nes les les te: RRs eo ee ee eR * es es Roles Rots oles tote agner, administrator oi armpeoar vw ANY OWL UIA SL — 4 4 Laves ples Loan J per snare note on ( indrews, due i 60.00 ' ‘ ed eiestoe wee ef ete: & GATES ve HEE Household and .itchen furniture 500.00 Two houses and lots on .wulberry «t., 12,000.00 Votal VBI, 697. 60 Le. C. iagner ndministrator of oStuate of Geo.H.brown North Carolina, Iredeil County. a her transactiol } ltd er a de eUe CO le list attc Tota balance udvancement advancement U.s. ilie-bdwards,one third Credit by advancement By check 2/18/22 Si. Edwards, one third In Superior Court 3efore the Clerk. -— era % ar z INAL ACCOUNT? iministratrix . . \dwards deceased final account to be & true aud is a8 administratrix of said estute ‘ - ail desk ou 6 nm) Claw Le sts t rney 110. dO 150.00 145.12 y1l10.00 45.12 % Edwaras, chest pillow qui quilt quilt blanket One eceasged ’ Cs twe Cavin Zeigler Cook Hobbs Miller Gavin Lt bed spread Center pane blanket Two blankets Counter pane Quilt lining Umbrella tne bea & pictures sneet ,ow cnaein 1 cnamber 1 cnamber 1 nand saw squure L trunk Ll tmunk 1 quilt J. Ne. Robins Troy Rimmer Minnie smith Dan Compton Y. Md. Morrow Hugh Cook Lon hogers i. Seigler Hd. Brown ait Cavin Varlow J. Zeigler B. 2. Smith 1a Brown Ola Freeze Vom kKoltsnouser wnite Lipe e Christy Pair i. Zeigler ite + eMatnewson Carl Morrow @loth 1 lot cases lot cases 1 1 lot cases 7. sheet l sneet Total amount. ite Smith being true and accurate estate ceived ior wugust 19th, 1922, &t said sale, subscribed en North Carolina, Iredell County. in the matter of 4dministrator c. t. &. Be lebLaughlin. To the Superior Tne undersigned B. licLaughlin, accounting in tne 1. To balance on hand fro! 2. Sept. 24,statesvilie subseription stikeleatner, S. Deol, vs Tr MeDougeld vanced for TT... SO T ea = er a De VOC oe Hh, Ver Ue VECeih, ° Ohe weve o4. retun J ignlin Bid bY COLL VOrnel1us iebb, Balance of note June 1b, ichard McLaugnlin repaid to tne the amount advanced to him Nov. 2&5. «Fs. is 3, licLaugnlin, repaid ti ivanced to ner tor expenses irom time ti nown by the settlements in oraer tO square r account Nov.z8. lirs. A. B. liclaughlin,Guardian of «rank weLaugnlin,refunded money advanced for srank's sOllege expenses by the estate Nov. 2S. “rs. R. B. McLaughlin, Guardian of John licLaugnlin, refunded money advanced for Jonn{s expenses Nov.29. Buren Jurney,1/2 the sale price Mills’ lot Cred 921 — a7 | wy aiid soe t ? r reo Ve Ciie ie wIS e ld “ “ aS @ tte et gg ih aes l ets hare t ay ¢ 7 a Wertimerc ew, te S@UUY Mi’ i. + eon JONN MC+&augnsiy Keet.PTe & WELL & PLAKE wOOWEI n14 \ Saaisr a WOwEBURNLIN, Commissioner & 9 © of eh &T UNG eoenpr. 26, bie Penloexander, sheriff 192 24.Apr.26,City otatesville, taxes 25.4pr.29,iirs ade Murdock, Bal on note 26.Apr.29,W.C.Perry,Auctioneer,sale of stock a7.May 8, br. J.8eMclaughlin, on amoun due on farm settlement 28.May 17, Dr. J.H.MeLaughlin, on farm setilement 269,50 i +O, 191.84 ee an e s e Pe 29. May 17, Statesville Daily, advertisement sale of and against his attorney's stock allowed by law, or that | 30.May 25, J.a. Hartness, 6.8.6. ; state 55.2 Inthis comiection, Sl.May 23, R.G.Dun & Co., New York, refund unused court the process o costs : } ] a - 5 Me DedAClOAuCntli - -_ 9 : 32. May 29, Dr. J.Z.licLaugniin, balance in full farm setilement certé&éin amounts City of Sstatesville,street assessments 33, C.5-C. costs J.T.Stikeleatner, settlement in full witi of tnis attorney s acct. on nis loans C final 7,0. Tecotikeleathner , money collected ut naA¢ OQ, inLlve 14, urs. 5.B.lacLaughiin, cueraian of Srank, sdvanced on his expenses at Vavidason Loliege rom nis ; a one ae Sent te .- 3 koLaugn Guardian Frank ditto Ii Thompson for stamp ior Newnite deed special roceed ing Docket 1s, trom former receivts aliowed by sHargue, account eax snlexander, - Te vesid sin 10 my com .issions on . 4895.08 ut 5% , 244,75 To my commissions on ~4488.56 at 5% / 224,41 Total Credit 35054, 50 cle ese eee fe ep es eoleotes ese Balance on hand due tne estate 157.04 i uGEGEEGECEGGE Er 4% 5191.64 The balance of $157.64 together, witn the remaining personal prop- , ‘ wc f . oi ‘ " - 64 erty consisting of 10 shares of stock in tne first National Bank, 9 A Cu Ly [uf wnq hi, 4 ; shares of stock in the statesville Kealty and Investment Co. and 5 sheres 4 / f ’ i all Len 157 @ LEhite of stock in the .tatesvillie Chair Co., and 5 snares statesville «urniture Co. has been turned cver to ine Legatees under the Will and their re- ceipt taken, and ali claims, both against h.B.McLaughlin personally and 468 . I ' om an > | | . 2 } si s O} - ah oe i * 2 . ~ “| + er ia i n ba g 5 Ri a l oe pa i n i ca r et al s ———— vos nce i ed e m a . — se e A ga in a ce i s- Be 52 CE R E A L a ee ee re Oe @? Ba n ow e r ae in o Rs Final settlement of stewart, Deceised, Made Feb.10,1922 Oct. Oct. Nove pe Feb. 12,1923 July 51,1923 Heb.12,1923 Feb.12,1922 Feb. 12,1923 ,> 4 or La , LYSE » being duly s & true hxamined, audited « &pproved this 12th day of 1923. + © U w L s lerx te w eres Ve: reste HE Oe ese eee Bebe eee’ ess \ ® es e Mooresville, NN. .Jan.24,1922 the superior Court of Iredell Co., N. Car- 2 J hik ctille ie, « y t > ' 7 ? 6 12 LOW es L - j ] babs planat 10n Sp e e is tance of : ea ae : » namely final settleméntof bb administrator C.T..of 5 Martha Og Caldwell,made tnis ne lay of January 1922. ee above, purchased by Jame Lizzie VCs { [Inherétan > | , 466. 90 4466.90 erutees % o,e9ceL0 ame inte 1S edminis & D).Calawel deceused, ‘ormation und belief. =e onovDs ndministrator C.7.4.0f wartne D.Caldwell,deceased. sAaare aldwell is deud, leaving him survivi bwo child pie! ile to subseribed before me, HWOrh und 7 well und “enry Caldwell, both of whom & minorse this the 26th day of Jan. 1lY&e. "4 3 + } ew ao and left him surviving two children, JeW. Sharpe, Depte¥ i | | i ; es Weeokse: es ee ke oe Oe ee uN es les bc ee eales Wt Wee Ro Se ee $823,28 Received of J,A,Hartness, Clerk of the Suverior Hundred Twenty-three & 28/100 Dollars, the same being in amount due Ethel Caldwell and Robert Caldwell, minors as the last will and testament of Martha D, Coldwell estate. This the 26th day of lebruary, A.D. 1926 “L£O6 Court Hight full of the legatees under ae V5 ag ei i iaine tTuaktdion of Mtlel Caldwell and Nobert Caldwell, minors. 496 ‘ ~) sf : c 4 . , > Subscribed and sworn to ; ’ before me this larch lst,192: . 1 , « ° 4 ° ° x ° eee t ’ Final Sett ement « oa ie ] + ‘n, 4 4 > Ht , ipa L eceas a. a acu. g i \ * 1 q Al , a | i : . . ’ ° ° er bona . ) 4 | ; ‘ - “ Obs ‘ ° ° . ’ ee erest bag dhe Sell. BG ig i | Y é 4 . tnd ee | i : hd ’ Ce Li~ PE i , ; . ‘ ° . ‘ { ‘ ; + if 4 4 ” a - ¥ . a 4 ? ' gr : ’ + "act F Ms + , Liibé f u = Ge [2 ' " : : . 4 4 i ; nay C e ” ' 4 4 LY dg Set ¢ ‘ i . ! 1" e* | i t « « e& s 4 See —_—— i 4 - I BEVGes OF ce i s 4 i LILLE } ae 4 2 i | e 1 , P } Sores De BVe ee . pvenevVe . : 7 . ’ a v : . ‘Se e * ’ . : + ‘ e ‘ ’ ' ° i : 9 . . . i P| ‘: if 4 { - ; oth : ° 4 9 . . . 4 + e P 4 a ' l : 4 , : i e ° »% t ™ ' ‘ etiest 9 . ® t ’ ‘ *-¢ . e . ° , “a 4+ e 1 y eS @ , ' ' f F ; , - Y 5 , * et s. \A ° . . a c ‘ a 4 ‘ . e 4 . ve dV 7 \ eo ) . : 6 ° ‘ 0 L « } f € . } mw 9S ' ’ f t 1 == ° a oe . 6 4. , ° l e5eC,. bis tt nt os ; ; t « ° 9 . . . ota ! nts ' . , . 4 ot ‘ 44 + . 7 > 4 , saree Ccs i+ + 6 )O Joise ‘ , | t e 1YyY t e . 4 l z . ; Y te ’ . - ' , ' ' ee : > 4 ‘ " 90 ‘ . aid Lice . sul , one-sixt of bali e Bites 4 29, ' ' Onn Oc : j 2 ’ a Tl ‘wWrr " " ' , ai lese . ° elec wild A A Ad maa ~* 4 Ade te — ao soi 4 ? : 1 4 ” ‘ * oY o¢ ta } Y ‘ t eid Jd. & Furr . " ' 217 .8a9 i 1 . 5 ‘ ; " " onn oO @id W. Be urr 77,29 4 , ‘ t i ie ° zi. 23 ’ lal Seae . " "” ” onr 29 4 roau ae We TUuryzy 2776 a ‘ ; nts me 4 i > ‘ : Qn r a w "W " " a PA1G Us le FULT 277.29 el ‘ ‘ 7 . anmmenaie aoe } 7 Ty >»? 1¢ or ae g February 21,1923 ‘ 4 4 i « 7. 'G gurr, Th, : : . Executor J. » 2 wee . a ted d a roved \| a. ——— eee ii R.G. And T. D. Miller Administrators, C.Z.4. of Bell S. Barren a account ener : nee ne with said estate on final settlement with the Clerk of the Superior Ccurt $23,709.76 ® e h 27,1923. made Marc No. 28 J. A. Hartness, C.8.C. fees Received of H.P.Grier,fxt. of A.P.Barren,Cct.24,1922 1000.00 5% coms. on $2596.92 15.00 av Dividends on Statesville Cotton Mill Stock " * 57.50 5% coms. on $459.92 oe : 22.97 10 shares p.stock redeemed by Statesville Cotton Mill,Jan.25 1024.84 3 % coms. on $22,000.00 : oe, 660.00 " wv " 5 shares stock redeemed Recd.from W.D.Turner,Com. ofgsale of 2/9 undivided interest in Bell >. Barrown,Store houses & lots sold by order of Court in the ease of H.P.Grier et al. Ex Parte. Total charges “* Credited by the following vouchers: “"Mch.1,1923 514.58 22,000.00 $o4 , 596.92 Retained in expense of ac, Respectful .y submitted, rR, G. &..2,.0, Millar Administrator c. t. a. Bell 5. barran Subscribed & sworn before me Mch. 27, 1923. 7 J. W. Sharpe Dept. C. 5. C. 69.34 $24,596.92 No.l By expense check including notice to cred. Mch.1/23 $37.65 Audited & a proved J. A. Hartness No.2 Cost to J.a.Hartness,C.5.C. 6.75 ‘Bs Be Ue ‘ 1 Noc3 W.f.Turner,+tty. Mch 24/23 400.00 Credited by following special vouchers: wy Lid : : CEOS CARECEEECECOREEE CEG No.4 Dunlap orphanage of AR.2.Chureh in full Feb.25/23 500.00 connennneeneneaeee | H wo. T.Grier Miller in full of legacy , Feb.28,192% 500.00 | HG | No.6 Mary S. Miller in full of legacy =" " = * 500.00 Pinal settlement of J. A. Stuart,admr. of the estate of A.G. Stuart ie Mi Now? H.P.Grier,ore z : : _ Mch. 1/23 1570.60 deceased, made this 4th day of Apr. 1923. q Hi No.8 Mrs.Margaret i.Deaton in full legacy " " 1070.28 si a | "e i i N Pe EH. M ) " ” : Ht " iller in full of legacy csi 1922-23-29 Cash on hand $750.00 Beha) No.10 W.W.Miller,in full of legacy " " 1070.28 or Hi 1 va oo “15 v C.8.C. 1/2 cost in Stuart and Springs Wi No.ll Mrs. Janie M. Waugh " * " bd 1070.28 19Reb<2E Fate = * = $106.78 iM No.12 Mrs. Cora mw, Sherrill " ” - = 1070.28 1922-11-29 Paid to wdiow 5.00 i No.13 Neel vr. Miller " " " " 1070.28 1922-5-26 Paid to J. M? Miller --funeral expenses 85.00 Phy : | No.14 Mary Belle Miller " " " " 1070.28 1922-65-26 Paid to T. D. Crouch,M. D.--medical services 500.00 | i No. 15 Wary Yelle Miller,residency legacy " * 1070.28 1922-53-29 Paid to C.S.C+ for letters adm. oo | | No.16 Josiphine G, Miller in®full legacy 1070.28 1922-7-24 Paid to Statesville +rug C+ ~= sod | ' ‘ T . No.17 Josephine G. Miiler in full Sp. legucy 500,00 1922-9-26 Paid to Carpenter pavis Hospital 50.00 | No. 18 Julian 5. Miller in full 1070.28 1922-11-15 Paid to widow 5.00 i a 22<8- a naer for taxes 2.14 | No. 19 Bertha H. Miller,Guard.Paul E.Miller,Mch 1/23 1070 28 1928-68-16 -Peid to M.P.Alexanee’ "© > i -6- Wilson Warlick Atty. 16%. No. 20 Mrs. Nannie M. Turner in full sp. legacy" " 1070.28 1922-6-22 Paid to Met . ae No. £1 R.O. Miller in fuil legacy " * 8 1070.28 1922-3-30 Paid to Landmark notice to creditors . | , 10.00 No. 22 Mrs. Mary M. Mann in full legacy me aa ie 1070.28 1922-7-14 Paid to widow ‘ 3.00 No. 23 W. C. Miller " tr " " , 8 1070 28 1922-4-24 Paid to Widow | No. 24 Mrs. Rebecca ki, Cooper " " e Ss 1080.28 1922-68-26 Paid to “idow 5.06 | No. 25 Mrs. Harelline N. Nicholson " " n oo. 1070.28 1922-4-4 Paid to C.S.C. for final settlement 5.75 Total gzes.17 No. 26 florence Miller in full sp. & rec'd legacy 1570.28 oii i gf No. 27 J. W. . Commissions on receipts 4n sburseme ° W. Gy,Jr. admr. of J.P.Guy sp. legacy 3/1/23 500,00 ee April 4, 1923 Balance due estate Totel $750.00 sworn to hefore me this 4th day of April 1926, J.A. Stewart Cc COSSCOCEIALCECOCOCEELOE Ex ACG COHCLECHCE CLECCE CES North Carolina, In superior Court Iredell County Before the Clerk In the matter of 5 F. York, administrator ) ) Final Settlement of W.F.York, deceased. ) RECEIPTS Amount on hands &s saown by inventory and report filed in the office of the Cler« of the Superior Court of Iredell County in Book 10 page 589 of records cf eccounts of Ex- ecutors and sdministrators. $257.06 Received from'k.L.York for cotton rents May 1Zth,1921. 9.51 sale of One war saving stamp October,1921 4.57 12.60 neceived from 4,L.York for wheat “year. Total receipts DISBURSEMENTS 1920. : ; J. a Hartnegs,©.o.C.Hor letters of admr. Cct.6th,1920. $3.85 To Boone T.ner for automobile hire in collecting personal property Cctober,7th,and 6th. 4.00 To Darwin “ayes for services rendered in estate liov.4th 1.50 79 J.{%.Tharpe auctioneer for gelling personal property vecember 10th. 2.50 To Richard Mullis and Ben tork f.r help at sale of personal property Lecember 10th. 1.50 To C.a.Grose and brother for funeral expenses vec.1l 90.00 M.L.York for fertilizer sec. 14th. 5.90 fo @. #. York for hauling corn mill to place of séle becember 15th. 3.00 1921. To. J. A. Hartness for filing inventory and report of sale of personal property January 2rd. 1.56 To sentinel for advertisement for creditors Oct.15th 2.50 To M.L.York on claim against the estate,Oct.15th,1921 17.00 To ».#.York for services rendered in collecting person@ al propertyfor sale including corn ete, Oct. 15th. 5.00 To Lewis & Lewis «~ttorneys 25.00 Jo J.A.Hartness,(.S.C. for this settlement 2.76 To 8.F.York Admr. 56 on $2 ; e 83. 5% on $166.65 sisbarbemente wi — 2 . ® v 2.47 Total Lisbursements Ballance on hands of Administretor to be distibuted among the heirs at law and personal representives of W./.York,deceased. $95.42 S.#.York Admin. of W.?.York,lececsed. Sworned and subscribed before me, this the 17th day of March,1923. J.W.Sharpe DOpt. Code Audited,examined and avoroved J. A. Hurtness Cierk Superior Court Paid out cr to be paid cut the above amount of 995.42 us foltows:. ‘LAI 43 : “aA. / gii.gg Cacd I~ 94, Aartuya, ON. py? 7) Rebecca J.York S.#.York 11.92 iced r) je OA AA LjOot= Ce phn GY a Lee D8. York pra Lol pz ~— — _ aS “YY y LA 4A elle 11.92 bie on , War - aff t_2 C S-~G é 35 ¥ M.L.York 11.93 Cia es } 7° A. ShL LY OK MG ~ Mrs.D.A.Mullis 11.93 7 L ) ~ ALP 4 ( 4.F.York 11.98 | f cA ew R.B.York 11.93 0.C.York 11.93 CEACECEESCEHECAERCER SCREAMER: CEGSRESE Annusl settlement of £.B.Brawley,%xecutor of .#. Brawley deceased, 1922. Receipts August 9,Balance last settlement $3.17 Sept.14. One bale of cotton 32,24 ” Zl. One bale of cotton 29.54 - 23 One bale of cotton 31.27 m 24 One bale of cotton 80.03 Oct. 2& " ° e . 33.74 Gets Ts * - " “ 35.67 ” a, * " " °e 39.07 BeVs Vo * “ " . 40.22 ' " Cotton seed 40.52 26.66 Nov. 21. Corn “yor Is Total receipte 1922 Disbursements Oct. 3. Mrs. R.F. Brawley Nov. 4. E.B.Brawley,balance due on commission Nov. 11. Guano for wheat Nov. 8 Mrs. h.f.Brawley Nov. 2l. B. H. Stutts hauling wheat bec. 6. Taxes for 1922 1923. Feb. 21. E.W.Brawley,acid e be W. M.Neel,clover seed Mar. 22. 2. V.Turlington,atty. fee £.B.Brawley,5% com. on $342.12 receipts . " J.a. Hart ess,C.s.C. cost Total disbursements March 22. Balance on hands E.B.Brawley 5% com. on $161.21 fisbursements $50.00 46.07 18.94 100.00 2.00 51.00 13.20 20.00 10.00 17.10 8.06 85 4.90 E.B.Brawley does hereby certify that the foregoing settlement is true and accurate to the best cf his knowledge, information and belief. March 22,1923. E.B.Brawle y, EX. Executor Audited and approved, March 23, 19236. Je +e Hartness CCEG EGAEGRAGEGEGECE CGE CL EEECAGEGEEES Articles of personal property belonging to the estate of oP, Barren,de- ceased, sold by the undersigned administrator,at public auction, on March 6th,1923, after due advertisement as required by law. W.J.Patterson (ne picture frame 45¢ one picture 75¢ $1.20 (ne picture 80¢g;one rug ¥8.50 9.50 Cne rug ¥3.00 3.00 Mrs. A.M.Snerrill One refrigerator §20.pp; ome screen frame 80¢ 20.80 One rocker 25¢;lot of books $.05 1.50 Lot cf books $1.10;hall tree $1.75 2.85 One rug $3.50 ;one table 40¢ 3.90 $13.50 $26.85 * ” Mrs. H.?.Grier tne rocking charir $2.00;picture frame $1.00 One table $2.00;cane rocker $2.30 Cne Wabdrobe $5.50;bookcase $10.00 2 books 35¢;3 books 30¢ 5 books $1.25; bookcase $13.25 Cne rug 45.50 ;one rug ¥3.50 Chiffrobe $15.25;hell stand $22.00 Suit of furniture $59.00;one cupboard $2.00 Mrs. #.4.Murdock ecture frame g ;picture 65¢ Center table 93.55;center table 45.30 J.0 UcRorie One picture $1.50 ;one picture 75¢ Sereen farme 65¢; 2 rugs 5.00 W.Uu Shoemaker Me picture ; one picture 25¢ One picture 65¢;one picture 25¢ One cotton mattress $3.25;one rug 75¢ H.,M.Morrison One picture frame 85¢;clock 65¢ Cil heater 55g; one roccer $1.80 C.U.Holschlaw cture frame 50¢ iL.Gilbert ele One picture $1.50; rug 910.00 J.G.Nichols ; : One picture framelOg;one bed spring $1.75 Books 50¢;carveh sweeper 55¢ One chair $1.00;ice cream freezer $1.00 ai .#,Pressle One mattress $5.00;one cnair 60¢ Center table $11.25; perior set $40.00 Rug $7.50 N.M. Blackwelder Beds pr ings le50 curtain poles 5¢ Table $1.30;picture 55¢ Washstend $3.25;2 cnaire $2.50 Bocks 50¢;suit furnitre $13.25 One chair 50¢ $5.00 4.50 15.50 65 14.60 7.00 57226 61.00 1.50 8.85 90 290 4.00 1.50 2.055 - 50 11.50 1.86 1.05 2.00 5.60 51.26 7.50 1.55 1.85 5.75 13.75 - 50 $143.30 10.15 5.90 5.80 3,85 - 50 11.50 64.35 23,40 505 O07 ' senate aint J.5.Moore was sold by him on the 6th day of March 1923, together with the names of the purchasers and e list of the articles purchased by each individ ual purchaser,all to the best of nis knowledge, information and belief. H. P. Grier os Admr. of C.T.4. Of A. Pe B. U. Annas,being duly sworn, says that the above is a trme and ”° correct statement of 11 receipts and disbursements made by him from the estate of Walter M. Annes, and that there is no other personal property or funds belonging to gaid estate, to the best of affient's knowledge, informetion and belief. B._U. Annes Affiant in ba; Sworn to and subscribed b | - RINT RE ERNDAT ONE Me Wire cot $4.00;book 25¢ $4.25 BRB gts efore me, hy 8 ay of “arch,1923, | Mt) Book 75¢;one swing $2.40 2.15 | | J.W.Sharpe ii i Chairs 95¢;bed stead 95¢ 1.90 Dept. C50, WW | — | Mrs. Kinne : } | One screen frame 025 025 Ti : sve cacex covescceceeeca i Mrs. £.Ua 4£.Campbe Ne ed GS GCCOECE ah tne coal bin 90¢;books $1.35 2.25 2.25 Ii | Mrs. Gs Hen i | One parlor suit 930.75 50.75 60.75 North Carolina In the Superior Court i Ath Wea -Semple Iredell County Before the Clerk at ag Ocks #le0O0O;bdo00ks 75¢ 1.78 % i Books 55¢;porch set $7.50 8.05 In Re: Estate of Walter li.Annas,deceésed. Ai Wha! oa i cae uate bal . 50 ‘ B,. U.Annas, administrator of the estate of walter M. annas, ah | , 10.30 | hereby files his final report: ' t Mrs. J.D.Cochrane MBA |) Tot books 41.00 1.50 1.50 Recéipts: met: " ; e ; Maiti) urs. J.a.White —o jens Insurance carried by East Monbo Mill $1000.00 fe | MUTT 5 a - 00; 5 ks . ° ae 1 — e _— Insurance with Junior ‘rder 500.00 sf); iB i ; Mrs.romp Lewis 4 4 i Books bog;bo KS 50¢ a. Cash on hands 488.54 bt: Hi} 0 50g; books 6 . ii ee B.U.Anmas note 500.00 | perc , 210 } i Books 26¢;books 46¢ J.5.Waugh note 336. 62 1 Ht! Books 55¢;books 55¢ 1. 10 lain dee wih 200.00 at ; . © H | at E 5 ‘ks C * ( \ . e 0 2.45 Hi: Boo 95¢;bcoks v1.5 6.60 ¥woLs.17 Jeo.Morrison i Cne renge 919.00 19.00 19.00 Disbursements i hy a $27.50 | Mrs.B.H.Reid oo W.W Ervin ¥ Screen and window shades 6.25 ° J.B.Weugh 93,00 | | Joh .sloope 200.00 | One courcn cover 3.60 3.50 Mrs. “alter M. Annas f 0 ons 50.00 «.C.Johnson 186 1. 50 B.U.Annas as commissi 0 e * — Clerk fees 7.90 378.40 Gn -bagkepd;one rug 75¢ 1.25 1.26 “3370.40 $2046. 7 } Cire 5.00 5.00 Mrs. “alter M. Annas $441.15 Mrs.Mac Lov One rug $7-88.winacn curtains Junius Annas 441.13 $1.00 A 71.25 7.26 13 \ Mrs. Ye sie Wilkinson 441. N.#.Blackwelder | One tin cupboard 2.25 2.26 Togo Annas 441.13 | Total amount of all property sold FAE0.00 Bula Annas 441.13 | } ‘ } 2646.78 Mr. H.2.Grier being duly sowrn,deposes and says,thut the above and Royster Annes 441.13 $ | foregoing is a true and correct list of the personel property of the 8.05 nal settlement fee asia 4.P.Berron,which came into his hands, as administrator ,and which 6.80.54 Sworn and subscribed to before me, this the 29th day of March,1923, J. We Sharpe Dept. clerk soup. Court ecceaceecece cececcecaacecee COEEE CCOCOPEACANERECHEE COCEE Final settlement of S.T. Goforth , Administrator of W. A. Shaver, de- ceased, made this the 4th day of April,1923. CHARGES 1922 May 13, rroceeds of af£le cf personal property as shown by sale list $402.55 Cash from Flake Goforth from sale of rent corn 9,25 wT Ww 8.J.snaver = . oe 1.58 Total $413.36 DISBURSEMENTS 1922 Mar. 6. J.A.Hartness,C.S.C. for letters of Adm. $3.85 L.G Lambert, Auctioneer 2.50 Landmark for Creditors’ notice 2.50 J.4.Hartness,C.5.C. filing sale list 1.05 1922 Nov. 20. M.2.Alexander taxes for 1921. 8.98 " " " " " "1922 9.86 19.00 1923 Apr. 3. Dr. L.?.Summers for account 17.50 Apr.4. 5.1.Goforth in full of account 4.60 " " B.E.Weisner in full of account 15.22 sis D.L.Raymer, Att'y 20,00 ” " J. A. Hartness,C.s.C. 3.54 5% commission on $413.38 20.71 5% °° " $108.40 disbursed 5.42 Total iad. BS Balance on hands for distribution g278.85 Credited by the following vouchers, to-wit: 7 E.L.Shaver 1/13 - $21.45 Mrs. +elia Holland 1/13 - $21.45 Mrs. Lula Holcomb 1/13 $21.45 8. N. Shaver 1/13 - $21.45 Mrs. Victoria Feimster 1/13 - $21.45 irs. Lizzie Miller 1/13 = $21.45 Mrs. Lillie Furr k/13 = $21.45 =—EE—TeTeEeE=EleTeeeeeeeEeeeeee—ee eae ——=£= Clay Brown of Burlington N. Cc. and S N Shaver of Statesville, N. c, both being by me duly sworn deposes and say that they know the heirs of Nirg vinnie Nicholson, deceased, (true name said to be Namie Nicholson}; Clay Brown being a son and S N Shaver a brother of the said Mrs Minnie Nicholson, and that the only heirs of the said Mrs Minnie Nicholson are as follows: Clay Brown, Burlington, N. C. Age 21; Lawrence Nicholson, Yadkin County, Age, 1%; Thurman Nicholson, Yadkin County, Age 15; W C Nicholson, Yadkin County, age 183. tha (;$ 4b. ¥ . Sworn to and subscribed before me, this) the 24th day of July, 1950. A } f 4 / y : fo I 4 (/f y - fA ( ; Fi tL, Clerk 8f the Superior Court $5.57 Received of John L Milholland, C S C the sum of Five and 37/100 (%5.37) Dollars in full of my share of the estate of W A Shaver, deceased. I further certify that I am twenty-one years of age and entitled to re- Gbps ISSLOATL [> ceipt for same in my own name. This the 24th day of July, 1950. $5 437 Received of John L Milholland, C S C the sum of Five and 37/100 ($5.37) Dollars in full of my share of the estate of WA Shaver, same being one-fourth part of Mamie Nicholson, my mother who is now deceased. I further certify that I am twenty-one years of age and entitled to receipt for same in my own name, This the 24th dag of April, 1934 a y,) A, l Z, Lahdbltihad Ze ZEo. I hereby certify that I am the father of Lawrence Nicholson and know that he is now past twenty-one years of age. This April 24, 1934, ‘ WLAYL e Received of C. G. Smith, CSC th ( ve Ve omith, e sum of Five and 35/100 Dollers a. on wl share of the estete of W A Shaver, same being one-fourth Pp oO € Nicholson, my mother who is now deceased. I further certify that I am tw 1 twénty<one Pa titled to receipt for seme in my own name, en en ee ee This the 22nd dey of January, 19377 ~ Witness: // Ze il danas { YO 4 ee <~. fat 4 father pe 733 | $5.36. Received of C, G. Smith, C.°*.c the DoLit . G. 0% Ce sum of FIVE and 36/100 in full of my share of the estate of W. A. Shaver, same otal ne -fourth a Mamie Nicholson, my mother, who is now deceased., I further certify that I vs ntitled to receipt for same in my om name, me Caer eee Oe ee ee This the 29th day of April, 1939. Witness: UWE Rikt thf I. S. J. Shaver Roma Shaver Jettie Shaver Oscar Shaver Ollie Shaver J.A. Hartness,C.5.C. for the minor children of Mrs. Minnie Nicholson, dec'd. > FPR Ave ue eat Se as Total 1/13 = $21.45 V S.T. Goforth Administrator Sworn to and subscribed before me this the 4th day of April, 1923. JoW. Sharpe, Dept. C.5.C. The foregoing final settlement of 5.7. Goforth, Administrator of W. Ae Shaver,together with his vouchers of disburesments having been audited and examined by me, is hereby approved, this the 4th day of April,19236. J. o- Hartness Clerx superior Court GEGAOEPACAAAUHAE CO SE CGE EQEEOE GARSAEAAAERERE ESE North Carolina, In The Superior Court Iredell County Before the Clerk In the matters of Mrs. Kate W. White, ) = rete aAdmx. of C.FcAe Dre Le White ) FINAL SETTLEMENT To the superior Court of Iredell County: The undersigned Administratrix returns und shows upon oath that the following is true and correct statement of all transactions had by her as Administratrix in connection with the discharge of her trust: CHARGES 1922 1. April 1 armstrong Cotton Mill Dividend $35.00 , nd Dennis,Attys — R. Aprils 40. ee en Yannie Albert kortg.int. 16,00 ance Co. ° 19, Mutual Senefit Life Insur 008.59 + see Life insurance Policy . t CO~. . southern Life and Trus 478.11 4. April © Life dnsurance rolicy 5. July 2 Peoples ‘oan & savings “ank Dividend 6. July 6 First National bank,» tatesville Dividend 20.00 ° vidend 25,00 7 duly 20. statesville nealty & Inv. Co. ai Purniture account 12.50 64,00 7.50 8. Aug. 28. George Yotson, 9, Sept. 12.Mre. Blla i. Parke, furniture acct. Sept. 19. sept. 26. Oct. Be a Dec. 16. 1922 14. Jan. 15. Jan. 16. Mar. 20-6 hy April 6. Credited by the Following General 1922. lL, AOrLA 15. Ze Vay Ze rot A. Je Collins, “ rniture Acct. Dr. Roy C. Tatum,ele of ventel equipment ens trone Cotton Mills vividend y, G. MoLeod Note & mortgage with interest 100,00 46.00 2504.45 Peoples “oan & savings “Yank, divid. 7.60 stateuville Realty & Inveutment Co. Dividend Greensboro vecurities Yo.div idend Armatrong Cotton Mill, dividend Total Keceipts Je Bo Gill, vreus. Presbyterian Church ,Dr. fnite's Church Sub. stul Telegraph Co. 2. May 2. Wed Nicholson & von,#funorél Expe 4. May 17. JeaeHartnens,C.5.U- lr May 19 Ge in June 2l. } iheritance taxes A. Long,City Treus. full of »treet auvessments jisa Mary White, ne tes June 22 Statesville Laily, Notice to Creditors June LU. . stutesviile & Kealty & Invest. Co.#ires Insurance g, June 16, jtateuvijle & Kpalty & Invest. Go. cremium on bon 10. sept. 19 lle wopt. 2b 12. Wopt. <b 1S. vepte 20 14. Oct. Oat. 16. Uct. 17. Nov. £0. 16, Dec.20. 19. Dec. 22. 20. vec. 14, 21. Deo. 14 e Wm. White, sxpense Peer Seti so a 4 sdvertiegement . Nm. Nhite,sxpence of trip to %3- C. for estate . Wary E.Nhite,money due on > ' Py ucoount of Anthony White's “st. John a. scott, atty.egel mxpe. Expense of safety vox and transferring vecritices Kate “.White,kepayment of money udvanced for labor Loonard White ,expenses Trip to utatesville Leonard “hite,kepsayment of money advanced for hospital exp. of br. L. White Wm. White, repayment of money advanced for hospital exp. of br. Le. White George Long,City tuxes Sneriff Iredell County, taxes nvestmen ee. 1928.Jan. 16. tategy ii o Rogity 810. 23. april 6. Premium on residence J.A.Hurtnevs Cost of Final settlement 40,00 40.00 26.00 . Vouchers $20.00 4.11 193.00 47,58 182.00 225.00 2.90 1.10 1.65 22.41 224.02 46,00 200.00 486.60 100,59 76.11 28.55 12.12 24. April 6. John Ae Scott, Atty. Legal Services Total Balance due estate $2407.05 Credited by the following special Vouchers 1922 L. Yec.20. Leonard “hite #605, 968 2. Dec.20 Kate We White 605.98 S. Dec.ez2 Wm. W.White 606.98 Total ~ $1017.96 Balance on hand due eutate ~589.10 Which is equally divided,one-third euch,between ~“eonsard dhite,Wm A, White, und “ate ". White. The administratrix further shows tc the court that the following person@l property has been turned over by her to the legutees under the will of her testator, euch being of full ee and each being en- titled to a one-third undivided interest in all: Three shares Stock,Greensboro veorities Co.,10 shares vreferred stock armstrong Yotton Mille Co., Gastonia; 6 uhoree veoples Loan & savings “ank,Steteuville; b whsures otatesville Reulty & Investment Co.; 6 snares “irst National “ank, ~tatesville; 1 fourth +iberty Loan Bond; par value $100.00; % wheres Mooresville Cotton O11 Co, »tock; Certif- foate of Deposit for $200.00 “ational Yank of Sumpter,-C.Note and Mortgage eamuel bradley $460.00. “ote und “ortga,e,fannie Albert, $326.00; “ote and “ortgure, Blizabetn “mith $265.00; to be held by them as tenants in common. Wherefore having fully settled the Administratrix prays that she be discharged und the wurety on her bond released. & Kate ie White Adminietratrix “worn to and eubscribed before me thie the 6th day of April,19&%. d. W-Shar Dept. C. 5. Us qacececaccoace eqoceaccoccceccace. cance Tae foregoing settlement of sate fH. White,.dmx. of Dr. lL. White, having been examined und audited, ig hereby approved and ordered to be recorded. This the 6th day of april,1923. oouguaacaaccaccacacauces coc vases «aaeaaacaces North Carolina, | ‘ LYeffore the Cler! Tredell County. { ei vu / . 4tchel] s Adminis tratrix oa a - ol ?TTLEMEN T ry liltchell, decease 5 ‘arl Witehell ar ( el} . decease: pat” 1. Witchell Ona Sarah Campbell, dec: ELL COUNTY: allie Jurney, Fanni adwinistratrix of Jas, tchell, deceased, ’ red jiitchell an ther Q en , | Le k Mitchell, deceased, lef’ J ! ' t ra ad at ¢ + sale + ‘ er final settlement of 1id estate: paid to Clerk Superior Court S A> 4 ~ + imily Henderson, deceased, lef’ Jestol tienderson, minor, paj 7 eee 7 Wor yh aw nak neha wo apaonnl 0 rt 254.50 islam A , low hw ef IR a, Yao YUE poss “ 40,00 Prd tls OY Sreeulem 4) Ki t ( 400 eee eS 3409.50 $15.05 eceived S, Ulel Une 8 . & 05/100 Dollars same being in full of the aistributive shi +. Alfred liitechell an ‘thel Mitchell 1lnors rom e vames LUCNCLS \lfred Jil. ell and bth BA — deine Tee estate and which is bein ) pacr OL Ui + 4a eee made as nrovided b tatu L such 418Sc¢cs : 4 sli : Us benef ¥ m4 ry LLilLOs CliLa ae co 4 &30.10 7 Received of haan — 10/1.0¢ oll.ax “y Sallie Mitchell 4,00 estate and which ——me Ja made as provided 3198.56 210,74 ef Final settlement of Voils Executor of J..Murdock, Receipts. Cash in bank $156.38 Cash from bonds Cash from bonds stamps Disbursements B. MM. Moseely,burial expenses Jas. o- Hurtness, fee \. Melchor,witness to will H. 2. Leaton legal notice 2.50 C. V. Voils,commissioner 16.96 753 vU8Se ee a SLO7eLl fr} r C 7 Voss A ri r ‘ Check Mrs. d. jie Murdock 24.08 SLIL LE Tas ‘ A oxy . < 2 . "70 " 5 ‘ ~ c an ~ > \ C. V. Voils,deposes and says the ne is a true account of the settlement of the estate decease his March the <Oth 19236. Sworn to and subse 1923 . My commission expires. Cct. LO, (Notarial Seal) |. Me Smith,Exr. of W. J.Smith,dec'd in account with M. Smith,! + 4 deceased upon Final settlement... 7 i ~o gg] OY pe + 4 fo emt. received from saie C1 personas wen as per inventory of sale Jan. 7th,1919. » *) } we 29 To. amt. cash found on hand 5 Lbs ; n f / 920 4.82 To amt. received from suie of 161 lbs. corn §/8/1 Credits. vi Sts tS. amt. pd. d. i. Reuvis,expenses gl.00 amt. pd. Burial expenses J. ae Hartness, letters etc. Int. on burial expense for cooy of will Dr. J. i. Cain,medical acct. " G.R. NicHolson, 11/6/17 11/16/17 11/16/18 6/ / 18 North Carolina - Iredell County 3. Nicholson 6 i} de he following is the final account of WISe De Starett funeral exp. Je — se #. Ludwig,deceased, mude this 25th day of J. anderson crying sale aS ; kheceipts. N.S. Gaither for 1922. smount received from insurance payable tc the estate by Mutual tor taxes for. 1917 2 ance Co., wewark J policy eo Benefit Insure , Ne le For taxes for 1916 a ak. 7 L92fen ril ML, ¥...Hartness,costs letters $8.85 faxes for 1919 “xp. in connection with pclicy fekl yson witness tc a L. starr,attorney - Hartness, 5% on ¢212.92 of dec'ds Balance to credi ’ estate 76.6. Balance to credit estate 176.62 20 ) balance for distribution 186.62 for services Paid to the heirs-at-luw tributees tne following un by ; H. a. Ludwig artness,C..o.Ceinventory and = Mire. %.W.Melenor lement. Inv. nn n . Lu wig retuined on rece & dbmt.s 33.71 446420 yLo2.00 ; I Ludwig Ludwig re 40.60 Mrs. O.Ldunter 40.60 Ne le Ludwig 40,60 irs. B.I.Ulrich 40.60 LUAWIE 40,60 Mary Catnerine Ludwig 40.60 Total to neirs-at-law bis. a a 40.60 aericiency ae a subscribed and eee « Smitn,aeceused. this zbth day Final settlement and account ¢ estate of J.J.Levan,made tnis p . AB VO) 1 of testator yOb.01 eash on hand and in bank et deetn Oo! i . a - 1 rs 110.00 balance on timber received {rPOoM Neve Van 6.00 sale of sheep 37.50 sale of buggy 14.00 sale of farming tools Total charges CREDIT BY FOLLOWING VOUCHERS . personal property belonging to the estate of Henry W.Mil 2 uenry #.Miller, ; ; . deceased mac this 5th dav . 4 No. le Dre Le O- Gibson,doctor bill 65.00 feceased, made this Sth day of Ju an 1 quilt F.F.Pry $1.05:1 pillow / No. 2 Landmark notice to creditors 2.50 a of ae i pillow cause and quilt li 8 by o5¢ 5 i . } i me pe ro e . ' t . oe me oo ee £1.98 4 N« 2 7o administrator's bond for 1921-22 10,00 1 bolster 4 Bve © ¢ 1 bolster and towel W..Reavigs Het Unitas ae ** *¥ Pe + ; ¢ »y* , oP é Fad: 2 at ; ¥; ter W.. Reavis i } ‘ : - 4 oO¢g Sst@aw beds $7.4 = [ - Ao ' M * . ) . ' - a» ton . . rad - Q9o9 VA { ( , o~ Ate 24.04) aid t \ J { No. 4 To udmin strator'’s bond for 1922-ce 10.00 eM LLY 65¢ 1 r he ewe ae, straw bed see .ua i iW : g \¢ Z SUP a eG Beli et } or< lage 4 . a No. 5 deMediiller,funeral expenses 75.00 5 doz. fruit ie 1 DOG; 1 stove # OTA We 1a i NOe emeMILLIEY,1 2 2 aoz 11te Jars lis ‘ re ne r ro © ne J ed 4 evVek liay whe FX l LJ ‘ Of je rs aii ; ” , - . $ . » Pon 20.00 fe. f. YLoucner YU¢g; 7 4ars “re fey) Bow a as N e oO in fe x! er,a LCY ©: lee wee V'\ e ~e *Oll iy OO¢ 7.90 ii * ; b | . + ry z custer sets Pi t n 25¢:° q A . rn 7 urtness f \ 27 + 4a 4 . Vil fh BOF 579 L 8 y d a) a Ne 7 ev fim ie cat MeSH ,»ver eve . Porirea a “a ae - ie ere a be i . : 95 rOTKS ana spocns #. C. wil ian 25¢ fi H | 4 + + > it eve y fl iH Vila - efea 4 bl iy ae } a : ih te voucners ‘ ¢ oe 5 Our { . y f F i i i ‘ | isn rVve & ea ° 4 oe i ‘ 5 4 = ae : Boe, . se ih ist ny Nis Lov : oS g et a) , 7 + 7 e - 46 oi @ aden os . ‘ ; \ ¥ 3 ns O12 yw 1. re at a 1 ),07 : , * | | ° . s : } y y } «- he 14 ’ g } Yi LUGS oe } e] nts € D +tara -” . ‘ , i Wi 4 wo» 9.23 ee ee e “ f Ovg, l . y : i Hal red - Jekh : = . ¥ &YG ta 2 i ~ wa Cad 0g ; es ® i * r ¥* + ( he , uid j ee ewe nee ae emer new een ee eee -- . sess o GY, « i g bE ur ‘ ont ~ i i A “t o ) in| ywvoe 1 bowl and toner » ¥ +5, i 1 Wi , ee ° Dovey olde 3 Ta i) P +. » ¢ + + i i" ay tre) . e : . +5 $ ‘ aes . ' - e 7 e “ ‘ tt Hil q unt due sesamin trator from tne estate Vee Os Y “= 3 4 . t , . Halil) Bae rit! j vw 7 7 6 . + Ht L &@X@ veie FOLINTA we 3 J l @5¢.: BN Hi \ 4 a A . ° 7 f | I ap : - { 4 °a ne 1+ r nharces «nd $y ihe ite lZITOra Se > A Ie J ‘ he Lives Loe we Hy Wa liv t tutor's tate consisted *f the uabcve amount of cnargres ana in : \ aie i ei | ] ess Tang aa 4 + by } > 4 _ 2 , o> $ . 1 *~ geo 24d ~« se 4 . 4 t i ta tneretc a sma mount of housenold und kitchen furniture and ‘2 ’ a a eee sa fre 46 ae fo ° 6 i, e ® i) i " : : b ae . : , 1 . ey } +r af Farm y Tande y ‘ 1} is ali! ‘ fow } t t : | wuTtTtT Le eavaLs &2 smalii trac OT rearming .anas ill Be s : +h? { .4 ; 4 . { d | | Hy 3 eye Eee : . : L dinning table .5.Meson 2.5031 Ll Wel’. in ii | via "WC e4 + 4 } , ft é at 14! _ ‘i j 4 neovis fo¢g;i ce ( i ( Lard ie LOe ws i i 1 tn 2 e ; 4 weorty AnOroyx iM y $32 ) ) @) iis , * ’ ’ i Fi 1 # r } ’ snshni . rede L ZOU! v,v rtn apovorox mately ws e e@ ih * SY } i iy wean :+ na y é 4 aah . . . = [ Lf 4 vv i ~ ALIN . ty he oe | . + 9% e* i + t i 4 } . 4 i f t I indebteaness and < t I ; : 4 | i i yi ant +} > ‘ : L aia) ’ . 1 meat. CNOP ml e 1} a ° eo e ° | ' 1 bed stead “r. ls 25¢ -* ¥ ; 1 7 , £ 14¢f . ne 7 ‘ ’ : i A trat ‘ i 1 vidow, “rs. 4.d.Levan tor ilte witn tne oes 1 ioe acd y 9 : in | ’ ‘w eV => i ea LOuUUN wese - . | ; + } ) vay nd 1 . * } y + j Vv V e 4 Rid 4 iUC € Oy seVGal , ; aaa im Sean gt Se » aan TS owes oe 1 hall rack Mr. <i a +. 50; : Wes j , : , . Ll feather bed mr. HDichol . ’ ! : ™ i ' ' y 4 y ‘ 7 aK »? % Y - i } a t t t "In uSe BDdOoVe named chiliare euve me oi aa 4 : Se i , ” - ~ + LS vo~e? 5 ‘ s "Y "ne i ; sear ee » 4 . + arr ie 7O 1 ( rt oF Aer neirs e ie - 9 See Ol } 4 , 4 + : . - Ge ik ae fe } de A LUV + ~ © essen 4 * ‘ P i lor + + @ saya ai 7 y wer Ht } ) 4 0 f rv a2 Maus e o Se C a) 4 i : ‘ f . : eas than the exemptions allowed by ra) fi 2 q ites r n “ e 2s t « hi 4 t 4 } ; e 4 ccm 4 + . uw ’ ldre} Yr ecedent sone Nee ee oe ‘a oe abo , i | 5 C iV i VV 4 4 stead ae in ely Ble 5: 3¢ . A. ae , ; : " i Os s . ‘ ay i 3 + a i ff Cnalrse ese te % ‘i i ¢ J rite e ta * t bove named iegxarces, i 4 1 r 5 a “m. 2.4 ‘ De \ . it { " . C I YVeieild + ~* ’ : t } cb 1 . y A ees * A t - z 2 C sire - lie I { Le ° fi . - : ' : ‘ ti : , 7 ‘ , io 8 » and ; 9422048 . @.58 e . Levan being duly worn epcses that ne ebove is 4& true 5 pee ae anarly 55d :rt Ls « Bai G He's . ’ . ; 4 isOCKe] WS, mehoel 4, Vy s : 11 f 4 + sa? } , an n "tT f c “+ “ - . e A e/y f ~ 18) " } zs NOCKEY Ue ihe Fulford ovV¢,; ii és » > 7 4 T , asnowln the - 44 4 rrect account I al ttlemtn of tne estate of Jed. Levan, Snow e 2 rocker ° « 411118Nn cof, , : . . 5 / j rae ; ous ; i moainyn 4 e . 4 a 4 a} , } ’ ’ into his nanas or int¢ ve 9 woes : Y - amount tT propert W cn ume r Bhould have come into nis *“:~* a ‘ . _ ’ i bik neo C5 of Y tne hands of of uny other person for him, as administrator Veid- Total pest of Ha I » ‘ 136,10 fe My | . aid testutor, and now the same has been disbursed, all to the that ti bove a true and 4 K. Le Miller being 4 aly worn says hi f his knowledge,informetion und belief. einian > personal property 8 14 1 correct sale list, snow1il ‘ avtiali - &. Levan » ene entate of Henk) _ Miller, hdministraotor ©O.l.ea. Je J. Levan by him as administr Sor “» se %* i OTT nd subscribed bef anager of said articles, | | | oworn to and subscribed before me, deceased, the purcnasel f said ’ a i] tnis 19th day of April, 1923. brought, all t the best f his «lv J. A. Hurtness, C.5.C. Tris the 28th day v~ : , . »* 44 @ ij * Examined,audited and approved, this 186th day of April, 1925. Imi Te Tor CO. f. &e OF Henry ys" 9 - J. «a. Hartness Clerk Superior Court CCCUUSEGaecacGaccacaaegeced CSCRSGEKAr LGG GeeeeaEeaaadaaee eg ene scribed before me, £1762.19 Way, 1925. ae ’ ; WOe 25 tbe Le alexander, tax 1921-25 Nes Wed Mes Ket tees tes Nem eo Keo Re Oo es Uns He eee % Os : c 7 ‘ ‘ sv 4 > es ee ees leet ee tet let ht es Otte Het wee ed ete ded son I 22 3 LO. ) i {te waeanntor 7 s shaver, in auceount with said estate on » ‘ ‘ * - xy ; QOoa 6 2.DCNSe >t OF ++ nant made this the L1Yth day of april, 192¢ *. von u ° 2h. ) o On the aftresaid balance ee the ¥ ’ De Le 5 Subscribed and sworn to «pril 19,196 3A 44+ 7 ] ¥eAT At uw 4 ’ 4 , a - audited and aovroved rj ae toe + for 4 , 193 48.61 ae oz 0 ve . : A. a « AN ee _ 1 " G ' ns y ' l ~— ii i is c e i l e ao e . é \ shoemaker note 787,00 " Re J. «a. Hartness cost lund sale 18.60 " 24 Tax on deeds 5.00 i 24 Stutesville Cil Co. act. 30.72 ‘ i to before me, t North Carolina, In the Superior Court, 6 the 50th day of lay,1923, Iredell Comty Before the Clerk. J.4. Hartness In the matter of G. R. idills, j Administrator of the Estate |} PINAL ACCOUNT. of lirs. J. Blills, deceased. The foregoing finel account of G.k. iste a administrator of the A estate of irs. J.E. i i Se ddills, deceased, accompanied by his vouchers sup To the Hom. de se Hartness,C.5-C.: porting the same hav ' 1 of the estate of ldrs. J. E. Mills, de- ing been ceréfully examined end audited by me is | if G. R. Mills, administrator, : ereby approved and ordered to be recorded and filed ed respectfully returns and shows upon oath the following as a full, ceas : This the 30th day of way ,1923. just, true and perfect final account for settlement of his transactions J. 4. Hartness as such administrator. “ Receipts. CGE CEE Received from Commercial Natl. Dank ¥653.17 scoceecooecsccocecaece CCCRCEC UGE GucuGEe OvEGcagwded Disbursements. raid Dre Je De Talley y27.50 hy H. vs Furches, administrator, C.T.d. of estate of 7 N y Hart 4 7 * . ® Paid Dr. Rh. ». Mcilwee 10.00 Aeceased, in partial settlement of said catate. made thie the g&né i, y Paid Mrs. Herman,trained nurse 20.00 day of May 1923, ov i Paid Troutman Lrug Co. 3.05 } aid Trou 8 CHARGES Paid Landmark for adv. for creditors 2.50 1921 i} i) | Jan. 21, “a ity He Paid J.o. Hartness,C.5.C. 4.60 » “Slance on hands from last settlement $582.94 Hh 1923. Interest ; : ' paid C.S.C.Finel settlement 3.80 st collected in full to date 81.60 26.00 Total “bee. bt paid, \. «a. Bristol,attorney fee {otal y 96.45 administrator comaissions on repts. 32.66 CLEDITED BY THE FOLLOWING VCUCHERS: ' 1922 administrator commissions on disb. 4.82 Jan, 31,Taxes for 1921. y3.56 Totel y 135.93 y135..9% Nov. 1. Taxes for 1922. 5.26 Balance on hand for distribution among distributees yo19.eA : 1923 ; May 22nd,D. L. Raymer, Att'y 5,00 Paid to distributees as follows: P - May 22nd, J.A-Hartness,C.5.C. 1.25 Paid ae G. ii is y9S.93 ? May 22nd, 5% commission on $61.60 rec'd. 4,08 Paid G. V. Mills 95.93 ’ P May 22nd, 5% commission on $15.07 disb. 76 Paid Emma watson 93.938 May 22ng, Check to Clarence Freeland for Paid Mattie Cook 93.93 his undivided 1/7 interest in above proceeds 92.09 Paid va watson 93.93 Total $111.99 raid G. k. Wills 93.93 Balance on hands 562.56 Total amount paid jboo. bo H. V. Furches “Tdministrator C. T. a4. balance due administrator by estate 44.54 ss Sworn to before me this The said G.R. Mills, respectfully hands herewith vouchers covering the 22nd day of May ,1926 811 disbursements including those made to distributees. at sherpe Pp o ° Be ° Ge Ke Mills ee Zdministrator. ee opener The foregoing partial settlement of H. V. Furches, 4dm. C. 7. d, Of N. W. Hart, together with hig vouchers of disbursements having been R. audited by me, is hereby approved. This May 22ng1923. J. Ae Hartness Cierk S. Court. GAESSAGUESCLSIC GSGGEES CSGEEEIEGCOESCESCESS North Carolina, In the Superior Court Iredell County. :M.D.Redman,admrx of ) = ) PINAL SETTLEMENT. Mary Souther ,deceased. ) TO J. As HARTNESS, CLERK OF SUPERIOR COURT OF IREDELL COUNTY: The undersigned administratrix of the estate of Mary Souther, de- ceased, submits the following as her final settlement of said estate: RECEIPTS. Cash on hand at time of deatn of deceused $10.15 Proceeds collected from s- R. Williiems, note 601.00 Total % Bll.15 by foreclosure of mortguge DISBURSEMENTS. J. 4. Hartness,Letters of administration The landmark, notice creditors J. T. Jennings, burial expenses Dr. J. McHunter J. Le. Reid,expenses of connection with funeral The Landmark, advertising mortgage sele We C. Perry, ,auctioneer,two s&les Stamp for deed Probate and registration of deed C. o. ©. fee for final settlement k.T. Weatherman,attorney fee M.D.Redman,sdmx. commissions on collec. iM. D. Kedman,sadmx., commissions on disb. Total Balance for distribution ¥401.00 Distributed as follows and oredited on purchese price of land: Lodema E+ idsrlow #100. 25 Dore Williams 100.25 Bertha M. Williams 100.25 M. D. Redman 100.25 Me. D. Redman Administratrix of lary Souther Sworn to and subscribed before me, this the 15th day of May,1923, J. W. Sharpe Dept. © 5S. C. Tne foregoing final settlement of li. L.Redman,admx. of Mary souther, deceased, was tiis day audited, and the seme is hereby ap- proved und ordered filed. This the 15th day of Way,1923. J. A. Hartness UG. Be Ve COEELEEL GEO CE GACEGEGEGAGE GEGCCECE CECE CSEUESEGEGAL EES The following is an inventory and final settlement of Lb. L.haymer, Executor of Sarah alexander made this the 15th day of lday,1925,towit: RECEIPTS 1922 May 23, cash received on certificate of deposite from First National Bank $356.85 May 23, accured interest on above item 25.97 Votal receipts Poor. 62 Credited by following vouchers, towit: 1922. May 9, The Landmark for creditors notice $2.60 May 23. Johnson Furniture “o. on purial+ expenses 164.00 June 7. " 36.00 1923 aul May 4, T. M, Allison,full of account 6.00 25,00 May 4, Dr. R. S. Holiday,full of account May 15, D.L.Raymer,att'y Co, on funeral May 15. — Purniture vo 136.20 May 15, J. A. Hartness,C.5-C.for probating ee will ° May 15, J. A+ Hartness,for letters Test. 3.26 May 15, J. 4. Hartness,C.s.C. for this settlement yt. Inaddition to the above, there came into the hands of the Adminis- Total disbursements trators the following property: 265 shares of stock of Commercial National Bank $2500.00 Sworn to and subscribed before me » ¥ 5 shares of stock,Statesvilie Loan & Trust Co, 300.00 this the 15th day of May,1925. « Le Raymer 20 shares of stock,Peoples Loan & savings Bank 1000.00 - W. Sharpe sept Ter S- Care 4 shares of stock, Iredell Telephone Co, 100.00 2 shares of stock,Iredell Farmers Union Wareh use Nothing - Le Raymer, Executor of Sarah ; The foregoing final settlement of D y 1 share of Stock, Clio Telephone Co, Nothing alexander,together with his vouchers for disbursements having been care- l United States Bond 1000.00 me is hereby approved. fully audited and examined by y app ia ces ie Aides, iar This Way 15th,1925. above property, was due by the administrators to the Distributees of J. 4. Hartness Clerk Superior Vourt the estate of Dr. J. E. King, as follows: Mrs. T. J. Wieber - one-fifth part GGGSGuGaaeeaeceace : Mrs. Nora King bess- one-fifth part EE : Mrs. anne cing Norvelle = one-fifth part diss “ess sing - one-fifth part .SED The cash und property belonging to ihe estute of Dr. J. B. King TORS. OF THE ESTATE OF J. EB. KING, DECEASED. has been equally divided among said Listributees by said sadministra- CHARGES. %1570.00 tors, and said administrators sre credited for same by receipts from 6,1918, Sash, “eoples Loan & Savings Sank ° 5914.16 seid Distributees for the one-fifth part due each Distributee. 6,1918, Sash Commercial National Bank ° This llth day of May,1923. 26, 1918, Dividend Comuercial Nat. bank 100.00 Respectfully submitted, 26,1918. Dividend 2zeoples Loan & Savings Bank 50.00 “¥7e1t.00— | Bessie king Total " Lucy king T. J. Weber administrators Feb. 918, J. «a. Hartness,(.».C.Letters 3.85 — : audited und approved, feb. 7,1918. Statesville brug Co. 1.60 : this the llth day of lay,1923. Jan. 17,1918. Crawford-Bunch urn. CO. 100.00 J. ». Hartness Jan. 17,1918, Ramsey Bowles liorrison Co. 4,00 : Glerk Superior Court May 16,1918, The Landmark, notice 2.50 caecoass ceecaecoecccese Sept.26,1918. G.M.Foard, Monument 335.00 eeeceeeceeaauces cee Nov. 19,1921. Josie Hartnesa,C.5.C. 74 25 ——— 7 Inventory of the property belonging to the estute of J. M.#reeze, May 11,1923, J. «. Hartness,C.s.C. 12.13 Total $500.00 Balance in hands of Administrators for Distribution $7080. 8 deceased, Real Sstate 160 acres of land @ 940.00 per acre $6400.00 1600.00 Personal vrroperty. Sank note 700.00 200.00 76,00 Notes, etc. Household and kitchen furniture One horse Supplies Total personsalty ¢ BOSE. O00 April 25,1925. :, Mre. Ae E. Freeze, 4dmr'x o: t. by 2eV.Turlington, Atty. CEECUG- COCEEC- CEECELECECS gecaceeae acceceaeccececce The following is an inventory and finel settlement of J. H.Stewart, La@ministrator of Ella May Byers, deceased, made this Jan.13,1923. CHARGES 1923 Jan. 13,1923, Cash received from J. H.Stewart, .dministrator of J. Me. Byers $136.29 Credited by the following vouchers 1922 06t.6,1922, J. ae Hartness,C.uv.C. %3.85 Oct. 5,1922, Dr. E-s-Little, professional services 33.75 co 8, Johnson Furniture Co. for funerel expenses 65.00 13, J.«o.Hartness,C.5.C. 1.75 5% commissions on $136.29 receipts 6.61 5% commissions on 4104.35 disb. 5.23 Total lle. 39 Balance on hands for disbribution Credited by the following vouchers,to-wit: One-seventh to Henry Byers 2-84 One-seventh to Julius Byers 2.84 One-seventh to J.Mé.Byers 2.64 (ne -seventh to Lester Syers 2.84 Cne-seventh to lirs.”.Teaster 2.85 " " " J. o. Hartness, P aaa Clerk and receiver for Eunice Laity” ~ it t¢ eee a | Byers 2.85 ; » poi Z¢¢ ane wiry J (4 part due estate of iirs. idinnie Lee kn Werk pork {+7 Waugh ,deceased, aq 4 2 84 | “4 LK, Lyrary Z Total § 15,.96- aig MLM a Sworn to and subscribed before me this Jan.13,1923. Cne-seventh to C.u.i/augh for the y > Li SF ye Soe J. Ae Stewart -——— Js Sharpe eons Dept. RY Court, Lane Lit 4G aukan us V . YY > a f YAKS AAW A The foregoing settlement of J. H. Stewart, Administrator of Elle May Byers, is hereby approved. Jan. 13,1923, Je «A. Hartness Clerk Superior Court eeacecesadecauwuvaececceeeaae CGCGucdcducd Cegaadacceaacauae Finsl Settlement of J. W. Auten, Administrator of Mrs. J.C. Bradford, deceased. 1921 Receipts Nov. 11. Note First Nat. Sank $300.00 " " Cash on deposit 108.36 * " Cash for bond 600.00 . " Interest on bond 12, 83 " 50. Sale of personal property 22.10 Dec. 6 Rents 2,08 1922 Nov. 1. Intérest 54.00 “Pl09g. 37 Total receipts 1921. Disbursements. Nov. ll. J. Ae Hartness,C.S.C.cost $3.85 Dec. 1 H. 2. Deston,legal notice 2.90 ” 2 Mrs. Nannie Brown, nurse 26.00 " " G. C. Goodman & Co. acct. 16.08 ” " 3B. M. MoNeely,funeral exp. 102. 50 * 5. Mrs. Lula Gant, nurse 44,00 ™ " Dr. Se Ae Rhyne, acct. 42.00 m 22 F.S.Honeyoutt, acct. 1,22 Nov. 6. J. H. Mayhew, auctioneer 1.76 1922 Oct. 28. Z. V. Tyrlington,atty. fee bradford case 10.00 Nov. ll. We J. Lazenby,J.?., judgment 127.80 ' " ©, V. Voils,acct, nae " " Mre. Flake Howard,acct. 20.00 Dec. 1. Z. V. Turlington,Bradford case 10,00 " 13. Mrs. J» G. Benson,nurse 18,00 " 99, ids, Lule Christenbury, part distributive share 200,00 1923, May, 26, A. L. Starr,atty., Luther Bradford-compromise 26,00 2,00 . " witnesa fees in Bradford case * tho V.Turlington,Atty. fee 5.00 - ee ee awit Total personalty April 25,1923. Mrs. A- EB. Freeze, &damr 'x a. ti4 by 2eV.Turlington, Atty. CERECUGe CACESE- COSSELSCCCS Zeaeeeeae “acaeeeacacacaces The following is an inventory and finel settlement of J. H.Stewart, Laministrator of Ella May Byers, deceased, made this Jan.13,1923. CHARGES 1923 Jan. 13,1923, Cash received from Jd. H.Stewart, administrator of Credited by the following vouchers 1922 | . Oct.3,1922, Je ae Hartness,C.u.Ce %3.85 Oct. 5,1922, Dr. EeS-Little, professional services 33.75 1923 Jan. 8, Johnson Furniture Co. for funeral expenses 65.00 13, J.o.Hartness,C.5-C. 1.75 5% commissions on $156.29 receipts 6.81 5% commissions on ¥104.35 disb. 5.23 Total illo. oo Balance on hands for disbribution Credited by the following vouchers, to-wit: One-seventh to Henry Byers 2-84 One-seventh to Julius Byers 2.04 One-seventh to J.lM.Byers 2.84 (ne -seventh to Lester Syers 2.84 Cne-seventh to lirs.”.Teaster 2.85 . * " J. oo Hartness, Clerk and receiver for Eunice Byers oe er il tuk 7 ( eee we WF Je Cne-seventh to C.u-i/augh for the part due estate of iirs. iiinnie Lee tu wok Look lea Lik, WAR « Waugh deceased, 2. 64 Total F 19.90- Uy Mere bw Sworn to and subscribed before me thie Jan.13,1923, J. Ae Stewart paministretore The foregoing settlement of J. H. Stewart, Administrator of Ella Mey Byers, is hereby approved. Jan. 13,1923 J. 4. Hartness Clerk Superior Court Ceeaeaeeececadeaueeceaceeeene CGCGucccaudd coeaadacaaaaeauad Final Settlement of J. W. Auten, Administrator of Mrs. J.C. Bradford, deceased. 1921 Receipts Nov. 11. Note First Nat. Sank $300.00 ” " Cash on deposit 108.36 ° " Cash for bond 600.00 . " Interest on bond 12, 83 7 30. Sale of personal property 22.10 Dec. 6. Kents 2.08 1922 Nov. l. Intérest 54.00 Total receipts “I099. 37 1921. Disbursements. Nov. ll. J. A. Hartness,C.S.C.cost $3.85 Dec. 1 H. P. Deston,legal notice 2.90 ” 2 Mrs. Nannie Brown, nurse 25.00 " " Gg. C. Goodman & Co. acct. 16.08 i " B. M. MoNeely,funeral exp. 102. 50 ' 5. Mrs. Lula Gant, nurse 44,00 . " Dr. S. A- Rhyne, acct. 42.00 _ 22 F.S.Honeycutt, acct. 1,22 Nov. 6. J. H. Mayhew, auctioneer 1.75 1922 : Oct. 28. Z. V. Tyrlington,atty. fee bradford case 10.00 Nov. ll. We J. Lazenby,d.P., judgment 127,50 ’ " ©. V. Voils,acct. 25.00 ™ " Mrs. Fleke Howard,acct. 20.00 Dec. l. Z. V. Turlington,Bradford case 10.00 " 13, Mrs. Je G. Benson,nurse 18,00 " 99, lirs. Lula Christenbury, part distributive share 200,00 1923. May, 25, A. L. Starr,atty., Luther Bradford-compromise 25.00 7 " witness fees in Bradford case 2.00 n 26. 2. V.Turlington,Atty. fee 5.00 - May 26. J. We Auten, 5% com. on $1099.87 receipts. " " " "on " $493.59 disbursements " J, A. Hartness,C.S.C, cost final settlement " [mheritance tax,rate 3% (niece) $526.15 " Interest on inheritance tax since Nov. 1,1922 . Mrs. Lula Christenbery, bal. distributive share 309.82 3} 1099.37 Je We 4uten Total disbursements J. We auten,sdmr. being sworn says that the foregoing settlement is true and accurate to the best of his knowledge, information and belief, ‘ Je We Auten Sworn to and subscribed before me this the 26th day of May,1923. Cc. V.Voils HN. P. Audited and approved, jdy 26,1923. Je 4 Hartness GC. Be Ue GC GREOSEEESELSECECEECES E@GCECUEEEEOEEEEECRECES Tae following is an inventory and final settlement of J. H.otewart Administrator of J.M.Byers,deceased,made this the 13th day of Jan.1923. CHARGES 27, Received of J.H-“tewart, Commissioner $107.68 l. ” " peoples L. & S. Bank,int. 1.11 2, e " J. H. stewart,Com. on the bal. due from E-“,.otewart on purchase price of land, Pr. $1375.and interest from Junel,1922y27.50, total 1402.50 1926 Jan. 9th. Received from Peoples L.& >-Bank as int. on 94 above money 12. TOTAL $b. 22 CREDITED BY FOLLOWING VOUCHERS. 1921 Dec. 24, J.a.Hartness,for letters Admr. 5.85 1922 Oct. 5. M. P. Alexander,taxes for 1921. 12.35 Cot. 7. Dr. K.E.Little,forprofessional serv. 8.75 1923 Jan. 7. Ee F. Stewart and Bro. for accounti 5.00 Jan. 13. J. %. Stevenson,for account 20.40 5 Henry Byers for account for money advanced on burial exp. 25.00 n Julius Byers for ace. for money ad. 22.50 " ” " & wife,annie Byers,for services rendered J.M.Byers during the last three yeurs preceeding death 200.00 Jan. 13. D. Le. Xaymer for legal services to th administrator in connection with the ; settlement of the claim of Julius Syers and wife against the estate J. o. Hartness,v.S.C, 5% com. on $433.02 receipts 5% com. on 9392.60 disb. Total disbursed Balance on hands for disbursements Credited by the following vouchers,to-wit: One-eighth of the above paid to Henry Byers 9136.28 " "Julius Byers 136.28 " "J.M.Byers 136.29 "Lester Byers 136.29 " n "Mrs.BeTeaster 156.29 wv " " "J.o.Hartness Clerk and receiver for Eunice Byers 136.29 - \ " " e " " " "J.H.Stewart, Administrator cf Klla lay Byers,Dec'd. cwe- I IGsAF wd (ne-@ighth of the ubove sum which is due the fey. 1,8, CFM Ue? © estate of iirs. ldinnie Waugh,dec'd. paid to Hires, Uicg Ip “799. C.4.Waugh. 156.29 we Mh ch CO W6fMAt ty ae AeAF « IGF « LTA J. H. Stewart Administrator. Subscribed and sworn to before me this the 13,day of Jan.1925. J. We. Sharpe Dept.Clerk S. Vourt The foregoing final settlement of J.H.Stewart administrator of J. M. Byers, Dec'd together w th his youchers of disbursements having been carefully examined and audited by me is hereby approved. This Jan. Je 13,1923. 4&- Hartness Clerk Superior Court eecancdececeeaee cece se eaceaccecaecec: Ceaceeee a _—_ A Lore 2 OBE { 4 ; IF) 00 yer. 2 - i at LEMEN THE ESTATE OF W. L. JAMESON,DECEASED, a or 3 °. JAMISON, ADMINISTRATOR. The Administrator hes received amounts 4s follows: = on hands at death of intestate $31.71 Cash on deposit First Nat. Bank of Mooresville,N.C. 181.33 Jan. 27th. Received First Neat. Yank of Mooresville, divi. 0.00 Jan. 27th.keceived cash refunded Post Office box 1.00 Rh from sale of 15 shares of liooresville — Pepieed Go, gold to JeaeHarrill at $31.25 pers.406.25 June 15th. Received dividend on jiooresville Te. Co. stock 26.00 July 1st. Received First Nat. Bank of Mooresville,dividend 30.00 iene Mth. Received #irst “at. Sank of Mooresville, dividend 40.00 July ist. Received /irst Nat. Bank of Mooresville, dividend 30;00 a end. Received First Nat. Bank of Mooresville,dividend 30.00 April 30th. Received Minnie L.Jamison,note and interest 204.00 ,pril BOth. Received ©. P. McNeely for 6 shares stock of a First Nat. Bank of Mooresville 1200.00 Total receipts. y 2601.94 The Administrator has disbursed amounts as follows: 1921. : Jan. llth. Paid 4.s.Jamison,expenses to Clearwater $27.94 Jane Paid hospital bill 29.00 Jan. Paid for telegrams 7.65 Paid Clearwater hospital balance 5.00 Puid alexander for cakset and box 185.00 paid Dr. Ruff, medical account 56.25 Paid exp. tickets bringing body of deceased from Clearwater,fla. to Mooresville 60.68 llth. Paid J.a-Hartmess,C.S5.C.costs 5.85 llth. Paid Minnie L.Jamison,expenses to States~- 0 ville and return to Greensboro,making bond 6.0 llth. Paid J.#.Jmison,expenses to Charlotte and stetesville and return 3.00 4th. Paid J.#.Jmison,expenses tc Greensboro and return in connection with estate 6.00 16th.Paid J.#.Jamison, expenses to Mooresville and return 2.00 17th Paid J.#.Jamison,exp. to Statesville & ret. 3.00 Mar, 18th. raid J.lM.Harry,funeral expenses 10.00 4pril 16th. Paid &.P,leaton, advertising 3.00 april Paid W. 2. Alexander, taxes 4.4 April Paid “xpress on shipment to J.A. Jamison 5.60 1923 April 2lst. raid Sieduont Wardle Co, for monument “aid Pharr, Bell & Sperrow,attorneys fee May 4th. Paid inheritance tax Paid Miay Sth. Interest on inheritance tex May 4th. raid expense J. i’. Jamison to »tatesville May 4th. Paid expenses J.i'. Jamison to Greensboro in connection with estate Total disbursements May 4th. Paid Clerk Superior Court, costs Total receipts $2681.94 Total disbursements 666.45 Bal. in hands of adm. for distribution y 2 049 This balance is divided between the four next of kin, brothers and sisters of the intestate as follows: To Lillie H. Jamison,one-fourth y503.87 To Minnie L. Jamison,one-fourth 503.87 To Jes. Jamison, one-fourth 503.86 To J.F. Jamison, one-fourth 503.87 ~ 2015.49 Receipts from the next of kin of said deceased for the amounts above set out are exhibited to the Court. It will be noted that the administrator in the account above set out made charges for traveling expenses incurred in gonnection with the estute, but it will also be noted that he made no charge for commissions for administering in the estute. The comiissioners allowed by law will be largely in excess of the amount retained as expenses, 4s above set out. NORTH CAROLINa IREDELL COUNTY J. F. Jamison, being duly sworn ,88ys that the foregoing is 6 true and correct account of all money or assets received by him as a administrator of W. L. Jamison,deceased; that all the property belonging to said estute has been converted into cash; that all debts of said estate have been paid, and that the foregoing is & true and correct and full account of all receipts by him as such administrator, and a true and correct account of all amounts disbursed by him as such administrator. J. #. Jamison Sworn to and subscribed to before me, this the day of May,1925. Je A. Hartness “€ierk Superior Court CECEEECSECESCEECS GEGEEAEEEEE CEGETIGEE ESS The following is a list of the property belonging to the estate of Blizabeth Shaver,deceased, which was sold by the undersigned executor on the 17th day of reb. 1926. article Purchaser Price Table Edd Gatton » 30 Safe W. 5. Shaver Chest Mrs. &.c.Jordon Dresser ' ” Cupbosrd Edd Gatton Clock Ray Gatton Stone = ” Skillet T. J. Kinser Pat J. W.Branton Skillet ab. Greham Shovel 4. Me. Shaver Iron J. W. Branton Pans T. J. Menser Pans rg. Wells Hook Odell sdams Table &. U.Shaver Gil can E. N. Sloan Sewing machine J.“. Branton Table G. T. McLelland Hoe Ed Gatton Axe R. S. Ham old table and bench badd Gatton Bed 8S. Hattie Sommers Bed S. Ge T. McLelland Bed 38. Ge T. McLelland Lantern Skillet Chairs Chairs Rocker Chair Shears Mirror Jar Jars Jar Bridle Books Junk Chest 3 jars peaches No.8 jars peaches Two preserves 1 jar Damsons l jar sweet pck. 2 jars 3 jars apples, Dishes Dishes Butter Lishes Jars Bureau Muzzle “ug Jug Pans Bowl and sifter strainer Lard can Crock & pot Coffee mill a. M. Shaver 4- Md. Shaver Mrs. Wells I. N. Smith “rs. &. P.Gordcon 4&4. M.Shaver G. T. MceLelland WeE. Shaver rs. Wells Edd Getton Check Martin &. M. Shaver WeE.Shavers Edd Gatton Clark Smith Edd Gutton Charlie Jones Clark smith Pink Mcsellend M. D. Tilley C. We Jones Hattie Sommers a. M. Snaver M. De Tilley Mrs. &. 2. Jordan ndd Gatton M. D. Tilley Edd Gatton Mrs. J. We McHargue Mrs. © 2. Jordan Edad Gatton Graham J. We McHargue Odell adams Chatie Martin qT. J. Menscer Mrs. &. P. Jorden Odell Adans J. We McHargue Stew kettle Ann Shaver Churn J. We Brantan Thbd Re Se Ham Me. D. Tilley Total $60.05 Onions The following property belonging to said estate also came into the hands of undersigned. N. C. Pension voucher 52.50 30.34 Cash on hands Cash in First National Bank on Savings account. 600.00 18.53 Interest on above item Totel $765. 22 We BE. Shaver ~~ Executor Sworn to and subscribed before me this JeW. Sharpe Dept. clerk Superior Court eececececeeeeucececcececede ceccecececesos eaeacaceucecaaceececececcececcecececceces Final account of I.G. salexander,4dministrator of the estate of John 4- Alexander ,decessed, made this 17th day of liay ,19235. Dre 1921 Mar. 4th. teal. deposit m. & F. Sank ” o kKent,note und ucc't C. ii. Settlemeyer ™ Dividend-sank of Cornelius ” 50. Kentehay C. ii. Kape Apr. 8th. interest on bonds "llth. sent ” llth. Sale rent corn-Morrison ° 20th. rayment on Bd heed note " ord. Payment ©. J, Brawley note May 12. xent - ¥. B, Bkexander S. J. Brawley note and interest Jan. 4th. Bel. note and int. on Ed Reed note e 10th. Dividend-Bank of Cornelius " 24th. Interest on bonds 6 24th. Bal. deposit-Bank of Cornelius Feb.6th. Note and acc't E. B. Bost " 14th. Sale War Savings Stamps " 16th. Victory & Liberty Bonds " 24th. V. B. Alexander,note " e4th. J. F. Barnhardt, note " 28th. C. V.dlexander,-rent Mar. 4th. C. 0. Williums-rent apr. Sth. Will Mayhew-rent 15th. Geo. Mayhew-rent Dec.2z2nd. K.L.Morrison-bal. note and int. . ” Dividend Bank of Cornelius 1923 Yan. 20th. Sale of Bank of Cornelius Stock Mar.23rd. irs. Te Ee Parsons-auto note & int. Apr.drd. Walley- hay C. V.Alexander~-interest und note Total receipts 1921 Feb. Zistede L.Caldwell - ass0't & Mar. 4th. C. W. Settlemyer-guano,& acct. Mar. 4th. Town of liooresville-water & light Mar. 7th. B. M. Mct%eely & Co. burial ex. Mar.l0th. J.a.Hartness,C.S.C.costs lar. Oth. W.l.Neel & Co. acc't. Mar.15th. Adv. eX. Mar.16th. Miller “rug So.-acc't War.16th. Barger Bros.acc't Mar. 16th. W. M. Freeze & Co. acc't apr. 12th. A.W. Gudgerelabor Apr. 16th. F.M.Reagan Apr.17th. C.T. Mayhew Apr. 24th. B. T. Rape Apr. 26th. Mooresville Graded »chool-tax Apr. 25th. Town of Mooresville-tax Apr. 26th. Iredell County - tox Apr. 30th. 1.E.Byers- labor $7.00 53.63 10.36 288,50 10.35 5.69 1.05 1.25 9.10 3. 50 6.50 5.25 3.00 1.50 44,57 17.40 169.75 2.25 § 79.49 50.00 27.49 38.02 334.25 645.40 698.16 96.60 235.78 220.65 180.32 2.60 12.00 551.78 50.00 750.00 1978.73 25.53 10.00 $9831.21 Stew kettle Ann Shaver Churn J. We Brantan Tab Rk. S. Ham Me. D. Tilley Total $60.65 Onions The following property belonging to said estate also came into the hands of undersigned. N. C. Pension voucher 52.50 Cash on hands 30.34 Cash in First National Bank on Savings account. 600.00 18.53 nterest on above item ' Total $765. 22 We B&B. Shaver ~~ Bxecutor Sworn to und subscribed before me this May 24th,1923. JW. Sharpe Dept. Clerk Superior Court eccecececeeeeuaececeececede ceccocececesos eacacaeauece cacecaceeceacaceccecceeccecas Final account of I.G. slexander,Administrator of the estate of Jo Alexander ,deceased, made this 17th day of liay,1925. DYe 1921 Mar. 4th. tel. deposit m. & F. Sank - " Kent,note und acc't C. ii. Settlemeyer . " Dividend-#ank of Cornelius ” 50. Kentehay C. ii. Kape Apr. 8th. interest on bonds " lith. Kent ” lith. Sale rent corn-Morrison ° 20th. rayment on Bd Reed note " 23rd. Payment ©. J, Brawley note May 12. nent - ¥. B, Bkexander 5S. J. Brawley note and interest hn Ae Jan. 4th. Bal. note and int. on Ed Reed note ° 10th. Dividend-Bank of Cornelius " 24th. Interest on bonds " 24th. Bal. deposit-Bank of Cornelius Feb.6th. Note and acc't E- B. Bost " 14th. Sale War Savings Stamps " 165th. Victory & Liberty Bonds " 24th. V. B. Alexander,note " @4th. J. F. Barnhardt, note " 28th. C. V.Alexander,-rent Mar. 4th. C. 0. Williams-rent apr. Sth. Will Mayhew-rent ” 15th. Geo. Mayhew-rent Dec.z2nd. K.L.Morrison-bal., note and int. ° ™ Dividend Bank of Cornelius 1923 Yan. 20th. Sale of Bank of Cornelius Stock Mar.23rd. Mrs. Te Ee Parsons-auto note & int. Apr.Srd. Walley- hay C. V.Alexander-interest und note Total receipts 1921 Feb. Listed. L.Caldwell > ass0't * Mar. 4th. C. W. Settlemyer-guano,& acct. Mar. 4th. Town of lMiooresville-water & light Mar. 7th. B. Mi. Mct%eely & Co. burial ex. Mar.l0th. J.a.Hartness,C.S.C.costs liar. 1Oth. W.M.Neel & Co. acc't. Mar.15th. Adv. eX. Mar.16th. Miller Yrug So.-acc't War.16th. Barger Bros.acc't Mar. 16th. W. M. Freeze & Co. acc't apr. 12th. A.W.Gudgerslabor Apr. 16th. F.M.Reagan Apr.17th. C.T. Mayhew Apr. 24th. B. T. Rape Apr. 25th. Mooresville Graded »chool-tax Apr. 25th. Town of Mooresville-tax Apr. 26th. Iredell County - tax Apr. 30th. T.E.Byers- labor $7.00 53.63 10.35 288,50 10.35 3.69 1.05 1.25 9.10 3. 50 6.50 5.25 3.00 1.50 44,57 17.40 169.75 2.25 § 79.49 50.00 27.49 38.02 334.25 645.40 698.16 96.60 235.78 220.65 180.33 2.50 12.00 561.78 50.00 750.00 1978.73 25.53 10.00 $9831.21 May 6th. W. W- Rankin Co. -acec't. 12.50 heirs at law, as follows: May 6th. W- We Rankin Co. aco't 28.96 Mi {lle Durg Yo.-acc't 39.96 : irs. &. B. Bost 6th. Mooresv e 7 ° May advanced during course of administration as per May 20th. Dr. We D. Gilbmore-med ace't 90.20 checks and vouchers ¥ 700.00 May 24th. lire, J. We Byers-acc 't 2.25 $700. Paid at date of final settlement 141.70 June end. J. F. Gamble-surveying 72.50 Total . vel, June 14th. Summers & CO. ace't «40 C41.70 C. V. Alexander June 19th. Mert Mcknight Ne. Le 1.00 advanced during course of udministration June 26th. B. T- Rape-labor oS &@s per checks und vouchers de ¥700.00 June 27th. F. Reagan - labor 275 Paid at d&te of final settlement 141.70 July 15th. Bralwey-Commissioner 12.00 July 16th. Jd. Black 12.00 Aug. end. J. 4. Hartness-costs 11.50 V. B. Alexander Aug. leth. ?.S Williamson-Vonmissioner 15.00 advanced during course of administration Nov.29thestate of N.C.Inheritance tax 203.84 as per checks and vouchers 700.00 vec.10th. C.V.Voils-deed 2.00 e Yaid at date of final settlement 141.70 1922 & Total y 641.70 Jan. 10th. A.L.Starr-attorney 200.00 a Jan. llth. Town of Mooresville-tax 53.07 Mrs. a» Y. Neel Jan.12th. Iredell County-tax 185.89 advanced during course of administration Jan. 19th. Mooresville Graded School-tax 28.43 as per checks und vouchers 700.00 Feb. Zrd. J. K.Withers-admr.acc't 4.50 Paid at date of final settlement 141.70 Feb. 6th. E- Be. Bost-acc't 477.00 Total » 841.70 Feb. 28th. C.V.slexander - acc't 66.76 Mrs. J.#.darnhardt Feb. 28th. De 8. Turner & Co. acc't. 6.75 advanced during course of administration Nov. 4th. %chool acct. tax 9.41 &s per checks and vouchers 800.00 1923 Paid at date of final settlement . 141.70 Jan, 24th. lredell County tax 16.15 ¥ Jan. Town of mMooresville-tax 17.10 irs. T. Ee. Parsons Jan. J.#.Gable-plats 4.00 sdvanced during course of administration Jan.27th. J.4.Hartness,im C.s.C. 75 as per checks and vouchers 700.00 Apr. 5th. C.V.Alexander-labor 7,25 raid at date of final settlement 141.70 + ! r ° Apr. 5th. V. B. Alexander 4.75 Total y 841.70 May h. L. Morrigon-ace't 50.00 ; Mire. L.C.atwell May Monument expense 100,00 advanced during course of administration A.L.Starr, Atty. 100.00 as per checks and vouchers 700.00 %) 141.70 J.4.Hartness,C.S.C.costs final settlement Paid at date of fins] settlement San Commissions at 5% on receipts and dis= Total y 841.70 bursements on 912,308.37 due I.G.Alexander 615.41 Total geneial vouchers F097. 6k I. G. alexander ,dvanced during course of administration as per checks and vouchers 4700.00 paid at date of final settlement, . 141.69 Total e416 Total edvancements und payments out of personal estate $6735.59 6733.59 wo097.62 Total General Vouchers - page 2 " " " 6733. 59 Total special Total Lisbursements Under the terms of the will and under the orders of the Court the land mentioned in said will wes divided and partitioned among the above named heirs at law all of which appears of record filed in the office of the Clerk of this Vourt, and the gaid heirs-at-law and legatees were put into possession of the respective »arcells of land allotted to them by the Commissioners. I. G. Alexander administrator c.t. & -ubsecribed und sworn to before me this 26th day of liay,1925. li. licknight Notary cublic (NOTARIAL SEAL) {he foregoing final settlement of I. G. alexander, administrator c. te & of the estate of John a. alexander, deceased, has been audited and is hereby upproved und ordered to be recorded in the office of the Clerk. Je s. Hartness echt Clerk ouperior Court This 8th day of June,19235. eeeGeaceceéceaaacedees CACEGEESe GEECEVEEECEE were SOPESeRees OF pee 1. Miller, administrator ¢ Year 1923, March 23rd, Cash in Bank april 27th. Sash £. Johnson on note May 2nd. Cash ©. Rim.er on note May 16th. Cash C. Riumer on note June 5th, Cash (sale of personal property) June 7th. Cash E. Johnson on note June 12th. Rent on house July 6th. Cash £. Johnson on note July 17th. Cash for rent July 25th. Vash «. Johnson on note July ~5th. Cash E. Johnson on note sept. llth. Kent sept, 15th. Cash E. Johnson on note Oct. 6th. Cash &. Johnson on note Oct. 7th. Cash C. Rimuer on note Cet. 9th. Kent (house) Oct. 50th. rent Nov. 8th. Rent Nov. 2lst. Kent (house) Nov. 28th. vec. 6th. rent Year 1923 Jan. 9th. ient Jan. 1lzth. sent feb. end. rent March 12th. cash 4. “Yohnson on note March 20th. rent april 6th. rent April 2lst, Cash %. Johnson on note April 26th. K.A.Miller note and interest april 26ta. B. & L. Stock class a and interest April 26th. B. & L. Stock class B and interest Total | - Tea. of Henry W. Miller,deceased,made this 26th day of april,1923 ¥751.51 500.00 40.00 102.50 118.10 50.00 26.80 25.00 5.81 60.00 25.00 51.00 25.00 25.00 62.63 25.00 9.20 55.75 25.00 108.13 25.00 60.31 25.00 25.00 150.00 25.00 25,00 12.25 655,25 691.25 326.00 04 ae CREDITS BY FOLLOWING VOUCHERS : No. 29. The statesville Daily No. 50. Cain & Lipvard wiring house No. 31. W. uw. Evans, groceries No. 52. Yooper & Plyler, groceries No. 56. J.R. Ramsey, No. 54. J.E. Baxter No, 35. Statesville sentinel No. 36. Mrs. 4d. 4erman,nurse No. 57 Mrs. C- E. Bowles,cook and housekeeper No. 38, Laundry No, 59 R. o. Miller nursing drs. MM. a. Miller No. l. Dr. Sharpe medical account ¥100.00 Nok A.T.Nicholson funeral expe 245.75 No. 3. W. @ Nicholson funeral expenses 250.00 No. 4. Tax 75.52 No. 5. Tax 46.12 No. 6. Tax 56.99 No. Tax 17.46 No. 8 Lazenby, iiont. Hdw. Co. account 9,52 No. 9 Lazenby,iiont. Hdw. C0. account 11.62 No.10.Lazenby , Mont. Udw. Co. account 7.80 Noll. statesville Drug So. account 2.25 No. 12. sherrill Lumber vo. accoumit 26.63 No.18 statesville Brick Co. account 1.68 No.14. Barron & Conuer, monument 30.00 No.l5. We. Munday account 17.11 No.16. Ww. 5. Munday account 2.75 No.17. Imsurance 6.00 No.18 City water 2.89 No.19. Gity water 1.84 No. 20. 2olk Gray Durg Co. uccount 4.05 No. 21. Polk Gray brug “o. account 2.50 No. £2. 2olk Gray Drug Co. account 4.50 No. 23. J... Hartness,C.5.C. 6 .70 No. 24. James o. Hartness,+.0.C 7.50 wo. 25. James «. Hartness,C.s.C.Inheritance tax 87.04 No. 26. Telephone 2.00 No. 27. J. G Christopher 3.00 No. 28 3B. Le Sronce account 2.50 2.00 50.00 3.25 8.80 1.00 7225 5.10 20.00 23.00 4.70 20.00 1.68 No. 43. S. O. Laz enby, surveyor 4.00 No.. 44, Auctione er and clerk of sale 10.00 No. 45. Grier & srier,attorneys fee 210.00 No. 46. James A. Hartness, C. 8.C. f No. 47, James A. Hartness,C.s.C.costs in special } | proceeding to divide land 22.065 “o, 48 James «a. Hartness,C.S.C.recording inventory and f ; sale list L 1.05 Total amount of vouchers $1,456.50 Commissions on $3,884.49 receipts at 5% 194.22 Commissions on $1,438.23 disb. at 5% 67.67 | Total vouchers and commissions Gl, 700een Balance in hands of administrator after paying indebtedness and cost of administering estate p2,164.27 I Under the last will and testawent of my testator Henerie Miller is to be paid $600.00 with interest from January lst,1921l. This mekes the amount due i her to date $685.00. see will of the late Henry W. Miller,I am paying this legacy into the office of the Clerk of the Superior vourt of Iredell County. SPECIaL VOUCHERS No. 1. Receipt of James a. Hartness,0.5.0. for gix hundred and eight-five dollars, same being payment in full of the legacy due Henerie Miller , with interest to date, under the last will and testament of Henry ‘ W. Miller, dec'd. __ $685.00 0 $1,499.27 40. R. a. Miller on account dirs, ii. 4. Miller 7,50 BK) es” No. 41. Cooper & 2lyler, szroverieg 6. 56 No. 42. The Statesville Daily, advertisement Balance after paying the above legacy In the special proceeding entitled :R. a. Miller, serr. L. Miller in- dividualiy and as administrator of CT. A. of Henry We Miller, deceased una Henerie Miller by her general guardian, Mre. Carrie 5. ANROws brought for the purpose of dividing the lands among the devisees of my testator, it became necessary, in order to secure en equitable i= vision among seid devisees, to consider end ellot the funds in ny hands belonging to said estate as real estate, and the commissioners appointed in said proceeding under the orders of the Court, so consid i? undred ered said funds and allotted the same estimated at Fifteen Dollars to kK. 4. Miller, in order to mke his share of the real estate of equal value with the other devisees. For full perticulars see report and final decree in the abve entitled proceeding. Agreeable to the judgment in said proceeding, I have paid over the above sum of Fourteen Hundred Ninety nine end 27/100 dollers to the said KR. a. Miller, as evidence by nis receipt and special voucher. SPECIAL VOUCHER OF R. A. MILLER His receipt for Fourteen Hundred Ninety nine und 27/100 ($1499.27) in full of the amount allotted to him by the commissioners in the above proceeding mentioned, in order to make equality in the division of the real estute of the late Henry |i. ldiller among the devisees. Kerr Le Miller being duly sworn deposes and says that the ubove and foregoing is a true and correct statement und account on final settle- ment of the estute of the late Henry i. Miller, showing the amount which came into his hands, or into the hands of any other persons, as admin- istrator ©. 7. a. of said estate, and how the same has been paid out md disbursed, all to the best of his knowledge,information and belief. k. L. ddillsr Administrator clea. of “enry ii. Willer, deceused. eworn to and subscribed before me, this 9th day of may,1925. veWe Sharpe Dept. ©. S. C. Examined, audited and approved, this Yth day of lay , 1925. J. »- Hartness Clerk »ouperior Court eGSOGe ECE RAE CE GECCEEE EGGGGuUceaeeeeGeueGecee POs 1 of 9.0, Martaiee sag fas tf J. VV pe een North Carolina A ieee ; : In the Superior Cour Iredell Count 7 Before the Clerk In the matter of the ) Setate of Ais, Sin‘ivdoox } 70 Seomimar. To the Superior Court of Iredell County: The undersigned administrator respectfully returns and shows the foll.wing 4s @ true and correct statement of his transactions as sdmin- istrator of the above entitled estate, april S1lut,1923. i.... Mills, note and interest yo24.05 May 7th,1923. To sale of 5 shares Paola Votton dill Stock 1075.00 Total charges Credited by the following vouchers: april ord,1923. J.«.Hartuess, Cost of letters /pril 2nd,1923. R. oo. roston Preperation of grave May 7th,1923. statesville laily Notice to creditors May 2nd,1923. vi.T. Nicholson und son funeral expenses 7th,1925. Barron and Comor seserved to pay for tombstone 7th,1923. Cost of settlement to Jes. Hartness 7th,1923. To my commissions on Yr. My comsissions on disb. May 7th,1923. John «.scott,dr. atty Total credits } 450.14 Balance to be distributed Credited by ..pecial Vouchers 4s follows: Mrs. Elinor Brooksher 1/3 #513. 64 May 7th, by her receipt $313, 64 R. M. Murdock, 1/3 $313. 64 May 7th, by his receipt $313.64 J. Walter Murdook 1/8 $313.04 May 7th,by his receipt $313.64 Total Special Vouchers $940. 91 The administrator has not filed a state Inheritance Tax Inventory en Seen SON SAEs OY P ne sale of the late J.i.Deal h tat i . gned nd and two children of the deceased. The Administra~ administrator on the 24th day of Feb. 1923 a agave ares are the husba t certain advancements, made by the Coal D. L. Morrow 4 2 Me v4.00 tor further shows of the record tha deceased in the sum of $300.00 to R. M. Murdock and $400.00 to Mrs. Wood " . 200 Blinor Brooksher have been treated by him ss gifts by their mother to Grind stone W. Hd. Hunter 265 her children in her lifetime and no account therefor is made. Corn and box Sc @, Seine ae J. Walter Murdock Oil can :dministrator of the Estate : 4. W. Johnson 210 of Ada M. Murdock Box Je G- Movetaon 10 ax " ( Sworn to and subscribed before me .50 this the 7th day of My,1923. Iron Wedge -. 2. Det - J. W. Sharpe Shovel & ax i aces ae Clerk superior Yourt - eal 05 Auger and hammer tse iy ¢ 4 The foregoing settlement, having been exe mined and audited by 7 s eimster 015 | Saw Car Watt .65 iS me, is hereby approved and ordered to be filed and recorded. lay 7th,1923 Cultivator Je a. Le. veal 1.00 J. A. Hartness Plow . 2.3 Clerk superior Court morrison 65 Piteh fork Bob Reid 80 li ia ee co ; seaadle {. E.Bowman .85 GSEELEEPEAUEECESESCACEGEEEEC VS GSUtiGAGSGGACSSSER CSSESCSSCSSS liope " .06 Pr. gears we W. Johnson 1.75 Te following is an inventory of tne personal property belonging Brush and comb C. «a. Brady 20 to the estate of J. 4. Deal,deceased, late of Iredell county,which cam Halter J. 7. Morrison 60 1 i into the hands of his administrator: Bedstead Oscar “eal 06 | One bank note or certificate Merchants & Farmers Bank $310.65 Box soy +eal -10 J One " a: ° " * ’ 886.12 : Spur O. T. Deal 05 | es i aes 7 . , ” 75.00 Roughness soy veal at yh 716.45 One note on R. Le. Deal 200.00 Wash pans J. a Deal 045 Cash on hand 88.72 $1560.49 Dishes L. P. Moore 225 Dish J. A. L. Deal 26 L. R. Deal 4administrator Cups and saucers T.E. Bowman 15 10 Dish & Saucers John durdock Sworn to and subscribed before me cs Glass dish Lizzie leid . this 24th day of april,1923. : “ Glasses Clarence Lea . Je We Sharpe Cup & dipper Foy Veal 10 Dept. Ww. Se Co Goblets Le P. Moose 15 Lamp Clarence Veal 05 Pitcher Rob Reid 20 Stew kettle Lizzie Reid Whip C. ao. Brady safe Bucket Table Ny Umbrella Lamp Dh " ea | Scissors } sey the Single tree oweep ih Cultivator I Hoes 2 Hi Hoes 2 nake Plow shares & } Ni " " Wire 5S. Pr. tongs Braces « Bridle Knife Plane Last Lub basket Jugs Bottles Brace & bit Coffee pot me Gun i ; 1/2 bu. measure Je Ae Le Deal 4. We. Johnson Foy “eal Clarence Leal M. Cline “ee Long Claud Deal T. E. Bowman Ae We Johnson W. uo. ddassey O. T. Deal Blaine Stikeleather &. Le “eimster 7. £. Bowman J. se Le Deal Lee “ong RKectar Blaine sStikeleather Foy Yeal ie oe Weagsey T. &. Bowman C. »-e Brady 4. i. JOnnson Blaine »tikeleather Clarence Deal Joe bailye hob Reid Blaine Stikeleuther Clarence Leal Bud “eimster Je &. Le Deal - 50 220 215 2015 15 240 -60 35 e268 . 25 56 235 215 220 -60 10 025 30 55 220 05 40 15 - 80 10 1.00 05 cob case sundries Knives Clock Table Pitcher Table Bureau Quilt " Featherbed Pr. pillows " Quilt " Counter pane " " quilt Sheet Pillow case Mattress sundries Coffee Mill Sundries Square Knives & Forks Saucers Dishes Oil can Dough board Dishes Cups & saucers Dish Bowls Dish pan Salt box Rolling pin Pitcher Pitchers 2 Clarence Veal 2200 Blaine Stikeleather 245 Mr, Hune .10 Lizzie Reid 3.10 . 90 Mamie Waugh 1.80 Lee Long 28 Je ae L. Deal 1.10 a. W. Johnson 1.25 Blaine Stixeleather - 10 Mamie Waugh 4.10 Clarence Deal 1.05 " 1.70 We sw. idassey a.20 Le. kh. Deal 1.50 We o. Mussey 85 Lizzie keid -90 Reid 76 T. E- Bowman 225 bee Long 60 T. E. Bowman 225 C. ae Brady 40 ¢ 28.50 Blaine Stikeleuther 15 Foy Deal 10 Blaine stixeleather «20 France Morrison 10 Rob Reid 225 We. a. Massey 15 Lizzie keid «70 Lee Long 015 Grover Massey td T. E. Sowmen hata ae We Johnson 40 ™ 05 L. P. Moose 0 . 225 W. A. Massey “86 Grover Massey “09 A. W. Johnson or ~20 Baa ine gtikelea ther pa s e Be a se Sn ge n e t AE RE N E E ee na n Pi n t o ai g gh i li n a as ei ah a h a ta t e r er e n t mn e m t t a a m c e n e =a A an n wt nh sr o a nn Bowl Glasses Dish Dish Straw tick Mattress Table cloth straw tick Bolster Bed springs Bed stead " Basket nuit case " hug Counter pane Bolster Sheet Blanket sheet Counter pane Pr. pillows Quilt Comfort Quilt Towles 2 Powéals 2 Pillow slips Pillow slips Pillow Slip Pillow slips 2 Chest Mamie Waugh " John Murdock Lizzie Reid Robt. Reid 7. E&. Bowman Vien. Massey Joe Baily Blain stikeleather ©". Bowman nw Blain Stikeleuther We &. Massey The Bowman Je ae Le Deal " Marvin Waugh we Wie JOHNSON We of. liassey Lee Long J. oe Le Deal " Gettis J. &. Stikeleather 4ee Long John Murdock Je we Le Deal i. Bowman Jd. de Le Veal " Matt Heimster 4ee Sondman Gettis Mrs, assey € 05 «25 225 56 230 235 -10 205 35 «10 225 40 20 15 - 86 245 - 50 - 50 » LO 10 220 55 - 50 7.50 15 - 50 - 50 255 025 10 15 45 10 50 25 -15 40 220 Wattress Mirror Bolster Chairs 2 Chairs 2 Rocking chair Chairs 2 hocking chair Chairs 2 Cook stove Bucket Chamber . Cracked Collar Table stool Table Box & table Total Bed steads & springs Jim Deal 6.75 Brady 025 4. ii. JOHNSON 205 Jim Deal 05 urs. Lioose 70 Jim Leal 1.00 i.G.Reynolds 1.50 O.T. Deal 85 ae we JOhNson 1.55 Lee Long 75 luatt “einmster - 50 iirs. licose 50 lir. Reid ~30 Joe bailey 20 C. Brady 05 liy. #eimster 15 att seimster 15 Lee Long 205 Joe Bailey att ¥82.90 Le Re Jeal, «»admr. Sworn to before me this 24th day of apr * 1923 a Je Vie Sharpe, Dept. C. De Us North Carolina, Iredell County @eceeceaeeeacecececeeecace ESSCEEAEAEGE EOECEEEAE OEE CE 4n the Superior Court Before the Clerk In re: Wek. Holmes, administrator) of W.C. dayes, To J. «ae Hartness Clerk of The undersigned administrator of the estate o ceased, submits the following 4s his final Received from sale of personal property Rent from cotton for 1921 n " " Bale of cotton hand deceused. ) FINAL SETTLEMENT. ) the Superior Court of Iredell County. f WeC. Hayes, de- settlement of said estate: RECEIPTS 5687.71 40.00 12.69 70.80 Rent corn for 1921 Rent corn for 1922 " cotton for 1922 Received from W.R. Holmes, Commissioner, from séle of land for assets Total DISBURSEMENTS J.a. Hartness,C.s.C., letters of administration 3.85 The Landmark , notice to creditors 2.50 Jan. 12th,1922. Statesville ‘tg. Co. adv. sale 4.50 “ * sg L. C. Mullis, store account 52.55 " " " John Tharpe 5.00 " * " J. E. Tatum 5.05 " ¥ " M. C. Wooten, clerk of sale 1.00 " n " " ° . year's support 1.00 for widow . " . Wade Lazenby, " ™ ™ 1.00 " * " We Ke wtroud,d. P. ” ™ 1.50 ° . " Dr. C. he Nicholson,account 40.00 May lst br. Pe. C. durney, account 9.00 " 26th. . Fred Bidson painting roof 8.10 ” Material for roof 7.50 " " Lila Hayes, widow on year's 50.00 sup ort May 26th,1922. T. F. Mitchell on interest on n. 60.00 apr. 26th, 1921. Mi. P. salexander,tax for 1920 38.84 Mar. 2ord,1922, " _ ua ” © i403 42.00 July 7th,1921, L. a. Boggs, ~“ept. serving sum- mons for widow's yeurs support 1.60 Jan. 9th,1923. Balance on widow's years support 164.42 spr. 17th, 1923. Me. P. slexander,tax for 1922 51.68 Way 12th, T. ¥. Mitchell note and interest from Keb. 5th,1921 568,80 May 12th.1923. Bruce Hayes note and interest 121.80 " " " " " fune ral eXPe 125. 00 " " "Barron & Connor for monument 27.00 " " " K.T. Weatherman, attorney fee 75.00 WeR. Holmes,ddmr. 5% commissions on collect ions 82.63 "We R. Holmes, sdmr. 5% com. on disbursements 75.84 ¥80. 54 60,50 166.02 686.20 PIC5t. I Mey 12th,1923. J.4. Hartness,filing final settlement Total W. R. Holmes 7.20 $T65E 26 Administrator of W.C.Hayes Subscribed and sworn to before me, this the 16th day of May ,1923 Je We. Sharpe “Dept. C. S. . The foregoing final settlement of W-R. Holmes, Administrator of We C. Hayes, was this day audited and approved and is ordered file@. This the 16th day of May,1923,. Je we Hartness Clerk Superior Court North Carolina, Iredell County In Re: W. RK. Holmes,Administrator ) In the Superior Court ) RBPORT OF SALE. of We C. Hayes, deceased ) To J. «a. Hartness,Clerk of Superior Court: The following is & report of sale of personal property belonging to tnis estate: Article Purchaser l horse collar L. C. Mullis 1 horse collar L.L.Williams L corn sheller L. C. Mullis 1 set buggy harness L. C. Mullis 1 buggy L. C. Mullis 1/2 of disc. harrow E. C. Hayes Lot of fodder B. FP. Guy 1 horse 4.F Harris 1 bridle E. L. Williams 1 mle L. H. Fraley 1 bridle Beorge Mowbry 90 bu.corn @.90 per bu. B. F. Guy 20 bu. corn " " " G. W. Ford 10 bu. corn " " " B. F. Guy " " no" Guy 10 bu. corn " Bot of corn @ 86¢ A.F. Harris Log car J. B. Herr is 1/2 interest in flues RB. C. Hayes B. Ff. Buy 1 stack hay Price 65 1.50 3.00 1.00 12.00 1.50 3.65 50.50 .70 70.00 1.00 18,00 18,00 9,00 8.76 10.28 2.00 » 50 16.00 1 double tree Fred Eidson straw by the bale (5 bales) N. G. Holmes 3/4 interest in drill Binder Grindstone Wash pot fable S Dish Cups & saucers Bowl Plates Can Cups Cups Water set Crock Crock Jar Crock Jar of lard Crock Jar Box hivit set Kettle Kettle Saw Tray Churn 4 jars Pan 14 jars " Jar Box tools Pan E. C. Hayes dM. L. Robertson E. L. Wahliams Fred Eidson " " C. li. Wooten N. 4. Stine Jim Vampbell John Fox Fred Eidson Mrs. Nat Gatton Harve Campbell Matt Gatton Mat Gatton Mary Williams Mary viilliams John Shoemaker Mat Gatton urs. sam duyes Bud Mowbry Carrie Hayes " " T. C. Davidson Minnie Willioms Bud Mowbry Minuie Williams Lave Stack Will Thomas John Shoemaker John Shoemaker hk. A. Elledge Matt Gatton B. Ae Blledge Matt Gatton Lee Rash Clyde Thomas Matt Gatton 275 1.25 10.00 65.00 «80 -60 1.25 40 225 45 15 40 55 e10 255 15 15 - 60 - 50 2 04 1.20 30 215 90 044 Grates Coffee Mill Churn Carpet Irons Bench 3 chairs 1 chair chair chair spade shovel hoe noe -e YP YF FY FY FY ES hoe Junk " Brace & bits Cross cut saw scale Funnel Tack cap Jugs & jar One waeder Plow stock Imp plow Wire stretcher section harrow Double plows Cotton harrow Chat plow Deer plow Hole digger Cutltivator oled load Cuiting box Bits 2 horse cultivator corn planter Scoop 2 horse wegon C. M. Wooten J. a. Padgett Mrs. Carrie Hayes T. D. Moore Carrie Hayes Watt Gatton Chester Smith Gus stroud Carrie Hayes Matt Gatton Matt Gatton John Thomas lM. ae Wooten E. C. Hayes fred Eidson Chester smith V. Kash John Thar pe Dave stack Ww. L. Davis lia. o. Wooten 7. D. Moore “, PP, Sharpe Mrs Harbin C. C. Holmes Fred Eidson A. F. Harris Fred Eidson E. L. Williams Fred Eidson C. M. Wooten N. G,. Holmes " " John Tharpe W. Pe. Sharpe Fred #idson N. G. Holmes Ww. P. Sharpe L. C. Mullis Thee Witmore J.E. Tatum " " « 50 05 05 «60 025 220 205 £226 1.10 » 85 250 015 220 2 20 1.00 1.70 -10 30.00 15.50 5.10 30.00 = —— re e s e Se e Wegon body Mowing machine Plow gears Plow gears Checl lines Bag peas Lamp & vase Pair pillows " " 1 quilt Frames Pillow cases Boots sewing machine 2 books 4 books 1 chair 1 chair slass cicture " Mirror Picture © shades box junk Bunch stuff Nails Pins Ghamber Bed Springs »prings " " Sed stead Curtains 2 bed ticks lable cloth Curtain Cloth vresser 2 drawers Ju. Tatum John Harris Lee Bash Lee Rash " Mack ldessic cim Campbell C. M. Hamlet " " Pp. O. Hamlet fred Eidson L. C. Mullis E. C. Hayes Matt Gatton lMaek wessick E. D. Wooten irs. sam “ayes " " Ben “arris John sox John Harris arthur Cranfield sred Lidson sord John Sharpe Mack wessick Be. o. Padgett N. G. Holmes Carrie dayes T. GC. Davison John shoemaker Harve Campbell Matt Gatton Matt Gatton “red Lidson Carrie “ayes #red Eidson Lave stack T.C.Davidson ford 1 table 1 lamp 1 lamp bureau Bucket Clock dresser organ watch picture picture picture bible sack 4 = 1 1 bible 1 1 1 1 sack bucket Lipper Nail box Pitch fork 1 dish 1 dish 1 pan Dish & cup Cake pans Dish Cen Box “dz ohears Table L table cloth Lesk Lantern Tub Coffee rot " w Pan ¥red Eidson lirs Sam dayes E. L. Williams Matt Gatton George Mowbry C. UM. Hamlet ZT. C. Davidson E. C. Hayes Le LD. Wooten liatt Gatton E. C. Hayes liinuie Hayes " " fred Eidson Je be. radgett Chester »mith irs. Troy Wessick ‘red Eidson Ee C. Hayes fred Kidson Ben Harris Carrie Hayes att Gatton b. L. Williams Matt Gatton duyg vam Hayes Lave .tack Ben Harris i. C. Hayes E. C. Hayes Le. C. Mullis Matt Gatton John Shoemaker E. L. Williams irs, Sam Hayes Barlie ldessick J. P. Taylor irs, Sam “ayes L. C. Mullis Pred Eidson d08 ia Salt box Offie James 10 Range Matt Gatton 6.00 saw John Thomas 205 Plane E. C. Hayes 1.40 1 safe Dave Stack 1.25 7 glass jars Beuleh Llledge 042 1 jar Chester smith 205 5 pans Carrie Sayes ~35 rot fred Eidson - 85 Box E. LD. Wooten 05 Kettle Car. ie Sayes 50 cil can L. C. Mullis «35 Cupboard G. We. Ford 5.87 Salt box Minnie Williams 05 Chamber Cartie dayes 25 Total $ 537.71 WeR. Holmes nomr. of We C. Hayes oworn to and subscribed before me, this the 15th day of may,1922. JeW. Sharpe Dept. &. 5. ©. CBeGee Gee eE@aGEeeeeeee GAGAC CU eG AUGEGUUGETwee North Carolina, In the superior Court Iredell County Before t:e Clerk. In the matter of Je%. omith, .dmr. ) ) RBLORT OF Salk. of wrs. ». J. Williams ) fo don. J. a. Hartness, Clerk of the ouperior Court of Iredell County. Your administrator begs leave to file herewith his report end sale list of the personal property of his decédent, 5. J. Williams, which sale wes conducted at the late residence of S. H. Williams in Iredell County on the 19th day of August 1922, at which time I sold the following described property at public auction at the prices shown below: 1 barrel W.C, Perry 245 2 halters W. li. Morrison 05 1 cutting box T. 4. Jones «50 cow chain Herm Cook 05 2 barrel Harrow & plow FF P HY YF YF YP wo BY PP PY YP PY eB ee John Christie, grind stone & half W.M.Morrigon basket 7 Tea. Jones brier scythe H. Compton grass scythe dhit Lipe scythe & cradle John Christie roll brab wire te o- Jones hog hanger fT. O. Ervin, bed stead Dan Compton boxes John Robins gamer 7. H. Hobbs lot fodder(2.00 per hundred lot straw hit Lipe cow Bob Huffman wash pot ii. L.Carier wash pot J. uw. Benfield One lot jars z 2 jars & keg kegs Lot jars « bucket 1 jar Lot jars & churn a eo a Jugs skillet lot pans pot John Chrstie, skillet lantern pan bowl * wash pans lot jars pot Pan & crock 1 pot Pan & skillet Pan & crutes Dish pan & di per Bowl . pen 1 sot plates H. Compton E. H. Ostwalt i.e O. Ervin urs. ~.L, Lawson Mrs. orl “ertin H. Compton kb. N. Beaver Molly Nanie Ee N. Beaver T. «a. Jones ob Nanny B. &. omith Yan Compton uenry Brawley Chloe ballard Whit Lipe M. L. Coyer Mrs. l.ogers Meat Compton Harrison Charles Ballard Mra. Deiie Compton «05 -10 «20 025 025 045 1.05 «50 25 wa s bowles dish tumblers Ka r & lot of knives dishes ¢y 1 dish 1 oil can 1 lot knives & f. 1 lot dishes Spoons 2 pitchers 3 cups dishes 7 jelly glasses 2 pitchers w dishes axe & sileyeurs basket sundries pr. dog irons wash stand ew e PF ee pr. dog irons 1 desk 1 candle stand 1 lamp 1-24 lbs. lard Sausage 1 lard can a Ww " 1 jar grapes 6 jars fruit S jars fruit 1 doz. jars 7 jars 2 books 2 glasses 6 books 1 lot books Blumes Almanac Cups & saucers E. L. Lawson Chas. Ballard #. Me Troutman Mr. i.ogers Had Brown Mrs, Nantz 4.5. Martin Andrew Senfield Calum Morrison Ww. M. Morrison E. H. Ostwalt Ed Brown " jade Cavin C. H. Hoobs uerm Cook 7. O. Ervin Dan Compton T. O. Ervin B.e2. smith Dan Compton R. W. Seigler Wade Cavin Ed Brown Dan Compton Kk. L. Lawson J. N. Robbins Mrs. Hobbs E. 4. Matnerson Ed Brown Carl Hobbs E. «a. Matherson Ed Brown &. L. Lapish T. O. Ervin rvs. E.L,.Lawson Ed Brown J. &e Christie 55 ~ 50 55 »20 - 50 «40 «50 56 15 20 225 25 10 . 80 ~10 -30 02 -60 -10 10 6.00 2.00 -10 3.56 1.15 10 +20 15 ~40 - 50 «65 256 -30 15 05 «20 06 15 ad eee anne 1 flour barrel 1 can 1 sale 3 smoothing irons 1 jar suger 1 jar 1 jug vinegar j jug sugar 1 table 1 steve 1 cupboard 1 " 1 bureau 1 box nails 1 box sundries l box sundries 1 crate jars 2 brooms 1 axe & shovel l bowlster 1 " 1 " i sheet 1 sheet 1 quilt 1 feather bed 2 rugs 1 feather bed l bed tick 1 table cloth 1 vase Quilt bowlster padllows counterpen bas ket counterpane feather bed 1 2 4 1 l pr. cards 1 1 2 books 1 box sundries Herm Cook Herm Cook Miss Smith Ek. L. Lawson J. N. Robbins Herm Cook J. H. Brawley E. L. Lawson Hi. Cook John Brown Be. P. Smith Wade Cavin J. G. Compton Je We Lipe Ed Brown Mrs. Rogers Wade Cavin P. S. Compton Troy Freese Ed Brown Calum liorrison " " We lM. Morrison J. N. Robbins Mrs. Cora Hubb. WoL. Carrier H. Cook digettie Baws M. J. Smith BE. o Mathison Herm Cook " " w. M. Morrison Hamp Clontz 4. Le Lapris Mary *erry Ww. C. Miller T. se Jones + 50 « 50 10 1,00 » 50 10 -10 -70 95 5.00 «50 025 2.10 025 76 1 1 bed spread Mrs. Rogers aint 1 quilt W. M. Morrison 2.80 Hi 1 quilt Troy Freeze 2.00 1 bed spread J.@. smith 1.76 Hi 1" Dula Lewson 2.25 diel +> é: Site ~ in Miss Cook - 50 1 lot sacks Wade Cavin 625 it 1 bed tick lira. Kogers - 50 Umbrella 4. Le Loftin 10 i 1 counterpane 6, C. Morrison 1.00 lamp chimney E. Brown .05 iH 1 quilt Troy Freeze oe 1 trunk J. a+ Chretie .30 in 1 counter pane W. M. Morrison -20 1 bed tick Dan Compton .40 1 ° Herm Cook 045 1 cross cut saw W. C. liller 55 7. 1 blanket Calvin Morrison 65 1 lot books Je a Christie .05 4 1 quilt J. T. Smith 2.50 1 spinning wheel T. 4. Jones 2.00 i 1 table cloth Lula Lawson 1.05 4 bee gums R. C. Mayhew 2.50 i 1 blanket B, P. Smith 00 1 book M. L. Lawson 10 i 1 bed tick Herm Cook »55 1 bucket ban Compton .05 Hi 1 blanket J.T. Smith - 80 1 bed set John Brown .15 i 1 sheet Herm Cook «40 6 chairs We H. Glontz 6.30 Hi 1 counterpane Mr. logers 1.55 1 wash stand 8.50 Hi 1 sheet Herm Cook -40 1 box paper C. li. Wagner .10 i ) Pillow slips 50 © table spreads 3b. 2. omith 025 Hi i 2 pillow B. W. Christie , 50 | 1 sash " .06 i 2 pillows Carl “obbs 1. 50 | 1 towell E. L. Lawson 10 ii | Sheep-shears,& glass jur sam Compton 25 towels R. W.Zeigler .05 t 1 testament Henry Brawley -05 1 coffee pot Lula Lawson -30 i 1 lot of books T. O. Ervin O02 cups & saucers wW. Morrison ell i 2 brushes " 15 cupts E. L. Lawson -10 } 1 table Wade Cavin 5.26 1 set plates " . 1.00 a 7 chairs,45¢ each Whit Lipe 3.15 Plates M. L. Lawzon .40 1 | 1 clock E. L. Lawson 2.00 cups H. C. Compton 025 : 1 clock i. be Clonta - 50 Knives Dan Compton 15 , 1 clock 7. O. Ervin 225 box E. IL. Lawson 10 | | 1 shovel Re W. Zeigler 1.10 Lamp Calvin Morrison 05 1 chair " " 1.50 Sausage Mill J. WN. Robbins - 50 1 quilt E. A. Matheson 1.60 Skillet M. B. Smith 005 : 1 quilt Calvin Morrison 2.00 , 2 stand bees J. C, Lawson 3.80 1 quilt Herm Cook 2.10 Window curtains Herm Cook -10 - Lula Lawson 1.50 Total Fort L 1 quilt Herm Cook 1.60 Je. Smith 1 quilt Calvin Morrison 2.01 —" i 1 quilt Lule Lawson 1.26 Suorn to and subscribed ha ea : + onsts is the llth day of May, Troy Freeze 2.50 Je We Shar . | Deputy Clerk S- cout O64 ene OT LE Final settlement of Will Hoover and J. 4. B. Goodman, as administrators , of the estate of John Lipe, deceased, rendered this 12th day of May,1923, To cash received from the Clerk of the Superior Court of Iredell County, being amount due my decedent from the estate of George Franklin Lipe, deceased. CREDIT BY THE FOLLOWING VOUCHERS No. 1. James A* Hartness,C.S.C. cost of special proceeding entitled:Mrs. W.ldisHoover et Sl vs. Je A. B. Goodman and Will Hoover, as administrators of the estate of John Lipe ,deceased, including therein letters of administration $9. 94 No. 2 Grier & Grier,attorneys fees 10.00 No. 3. James «- Hartness,C.s.l this settlement 1.45 Total pel.o9~ Commissions on $61.87 receipts at 5% Commissions on $21.39 disbursements at 5% Total commissions and vouchers Balance in hands of administrators Under the judgment of the Superior Court in the special proceeding entitled, Mrs. W. M. 4oover et al vs. J. A- B. Goodman and Will Hoover, administrators of John Lipe, the above balance is due and payable to the following named parties, and in the following amounts, 4s set out in special vouchers, as follows: SPECIAL VOUCHERS: no. 1. lirs. J. a. B. Goodman,1/3 thereof being $18.11 as per her receipt No. 2+ lirs. W.iM.Hoover 1/3 thereof being $12.11 as per her receipt No. 3. James Lipe 1/30 thereof or $1.21 as per his receipt No. 4. Robert Lipe 1/30 thereof or ¥1.21 as per his receipt No. 5. Calvin Lipe 1/80 thereof or $1.21 as per his receipt No. 6. Jesse Lipe 1/30 thereof or $1.21 as per his receipt No. 7. Mrs. Bettie Pope 1/30 thereof or $1.21 as per her receipt. No. 8 Mrs. annie Sradshaw 1/30 thereof or $1.21 as per her receipt. No. 9. Mrs, “tta Galliehigher 1/30 thereof or $1.21 as per her receipt. No. 10, Abe Lipe 1/30 thereor or $1.21 as per his receipt. il. W. C. Lipe 1/30 thereor or $1.21 as per his receipt. 12. Receipt of James A+ Hartness 1/30 being the share of Mrs. Minnie Mock,who when last heard of was living in 31 Pag , Texas. Will Hoover being duly sworn, deposes and says that he is one of the administrators in the above entitled estate + and that the foregoing is true and correct account on final settlement of money Which came into the » Showing the amount hands of said Will Hoover and J.4.B, Goodmen, as administrators of said estate,or into hands of any other person for them, and how the same has been disbursed and paid out, all to the best of his knowledge, information and belief Will Hoover Sworn to and subscribed before me, this 12th day of May ,1923, J. We Sharpe ‘Dept. GC. 8. 6. Examined, audited and @pproved, this 12th day of lay,1923, J. +. Hartness COSSSEOCACAAUAEAGELEECACSES USCCACEGAVAESAEVSAGOATE RAS Final settlement of Will Hoover and J. .-B.Goodman, as administrators of the estate of David sipe, deceased, rendered this 12th day of May, 1923, To cash received from the Clerk of the Superior Court of Iredell County, being amount due my decedent from the estate of George Franklin Lipe, deceased CREDIT BY THE FOLLOWING VOUCHERS. No. 1. James a. Hartness,C.S.C.cost of special proceeding entitled:Mrs. W.M.Hoover et al vs J. 4. B.Goodman, and Will Hoover, as administrators of the estute of David Lipe,deceased, including therein letters 8.94 of administration ¥9 10;00 No. 2 Grier & Grier,attorneys fees 4 No. 3. James «. Hartness,C.s.C.this settlement 1.45 Yotal e Commissions on $61.87 receipts 6t 57 Commissions on $21.59 disbursements st 5” jen Total commissions and vouchers Balance in hands of administrators ge n e eh we e i Under the judgment of the Superior Court in the special proceeding entitled:Mrs. WwW. UM. Hoover et al vs. J. de B. Goodman and Will Hoover, administrators of Yavid Lipe, the above balance is due and payable to the following named parties, and in the following amounts, as set out in special vouchers, 48 follows: SPECIAL VOUCHERS No. 1. Mrs. J. 4. B. Goodman 1/4 thereof being $12.11 as per her receipt No. 2 Mra. We M. Hoover 1/3 thereof being ¥12.11 a8 per her receipt No. 3. James Lipe 1/30 thereof or $1.21 as per his receipt No. 4. Robert Lipe 1/30 thereof or #1.21 as per his receipt No. 5. Calvin Lipe 1/30 thereof or $1.21 as per his receipt No. 6. Jesse Lipe 1/30 thereof or $1.21 as per his receipt No. 7. Mrs. Yettie Pope 1/30 thereor or $1.21 as per his receipt No. 8. irs. Snnie Bradshaw 1/80 thereof or $1.21 as per her receipt No. 9. lirs. Stta Gallichigher 1/30 thereof or 1.21 8 per her receipt No. 10. abe Lipe 1/30 thereof or ¥1.21 as per his receipt lioe lle We C. Lipe 1/30 thereof or $1.21 as per his receipt No. 12. Receipt of James a. Hartness or 1/30 being the share of lirs. Minnie Mock,who when last heard of was living in El Paso,Texas. Amount being $1.21 Will Hoover being duly sworn, deposes and says, that he is one of the administrators in the above entitled estéte, and that the forego- ing is a true and correct account on final settlement showing the amount of money which came into the hands of said Will Hoover and JAB. Food= man, as administrators of said estate, or into the hands of any other person for them, and how the same has been disbursed and paid out, all to the best of his knowledge,information and belief. Will Hoover Sworn to and subscribed before me, this 12th day of May,1923. J. W. Sharpe pept. Ce. Se GC. Examined and audited, ap-roved, this 12th day of May,192%. —4. see ort erk Superior Court Final settlement of Will Hoover and J. a. B. Goodman,as administrators of the estate of Stokes Lipe, deceased, rendered this 12th day of May ,1923,. To cash received from the Clerk of the Superior Court of Iredell County, being amount due my decedent from the estete of George Franklin Lipe, deceased. CREDIT BY THE FOLLOWING VOUCHERS. no.l. James A. Hartness, C.S.C cost of special pro- ceeding, entitled:Mrs. Wi.M.Hoover et al vs. J.4. B. Goodman,and Will Hoover, as administrators of t.e estate of stokes Lipe,deceased,including there- in letters of administration y9.94 No.2. Grier & Grier, attorneys fees 10,00 No. 3. James A. Hartness,C.S.C.this settlement 1.45 Total “h eleoo Commissions on $61.87 receipts at 5% Commissions on $21.39 disbursements at 5% Balance in hands of administrators Gooeoe Under the judgment of the Superior Court in the special pro- ceeding entitled:Mrs. W. li. Hoover et al vs. J.A.B.Goodman and Will Hoover, administrators of stokes Lipe, the above balance is due and payable to the following named parties, and in tne following amounts, as set out in special vouchers, as follows: SPECIAL VOUCHERS No. le Mrs. J. a Be Goodman 1/3 thereof béing $12.11 as per her receipt No.2.Mre. W. M. Hoover 1/3 thereof being $12.11 as per her reeeipt No. 3. James Lipe 1/30 thereof or $1.21 as per his receipt. No. 4. Robert Lipe 1/30 thereof or $1.21 a8 per his receipt No. 5. Calvin Lipe 1/30 thereof or $1.21 as per his receipt No. 6. Jesse Lipe 1/30 thereof or $1.21 48 per his receipt Mrs. Bettie Pope 1/0 thereof or $1.21 as per her receipt 8. Mrs. Annie Bradshaw 1/30 thereof or $1.21 as per her geceipt 9. Mrs. “tte Galliehigher 1/30 thereof or $1.21 as yer her " 10. Abe Lipe 1/0 thereof or $1.21 as per his receipt. 11. Receipt of James 4. Hartness for 1/30 being the share of o when last heard of was living in Mrs. Minnie Mock, Wh Bl Yaso, Texas. amount being $1.21 Will Hoc.er being duly sworn, deposes and says, that he is one of the Nortph Carolina, 4 In the S n the superior Court, j administrators in the above entitled estate, and that the foregoing is Iredell County, Before the Clerk, a true and correct account on final settlement, showing the amount of t's , : money which came into the nands of said Will Hcover and J. 4+ B. Goodman, : eo as administrators of said estate, or into the hands of any other person eae for them, and how the same has been disbursed and paid out, all to the Collected rents for » yi 4 best of his knowledge,information and beliéf. the said Rebecca York in the sum of vw Will Hoover To 24 yds, of Domestic Five yds, of cotton F Sworn to and subscribed before me, One towel ' One spool this 12 day of May,1926. Je We Sharpe Dept. C. bd. Co Examined, audited and approved, this 12th day of May ,1923. J. o- Hartness Balance due which - G ale 7 Clerk superior Court of Clerk cuperior this 5th day of GA GEECESECEOESREE SEE CHE SEGSEECEREE LACE SSECECSEOS f LS 5 — y - ¢} |b ro C Reis: . ZAC = ¢ iii rd oe we A fea an eins et C, Cane \\ oox. * ° Vinx 7) North Caroline In the Superior Court #ive plows \ Se ’ Iredell County Before the Clerk One two horse waon lire a wv ul One buggy Minnie Robb,Deceased, ee i : FINGAL SETTLEMENT luiscellaneous furm tools io ( + nn se ae eee Une telephone,and @JpLOXiMmarlely one and one telephone wires; also an widivided interest tia - £ land 3 at the time i of ] 43D luoney on nancs a telephone line lown us the Carter line. we OO W . 3 ae ~P . mules and one y hnorse 4 oho ; milcr Disburse milch .4 nts ae pproximately 12.5 Cash on hnand i1mnls vune 9th, LY eVo subscribed and is tne Ytn G2eL0 406 estate : . 2K IK DR OOK OK A OK OR OK OK OK ROOK OR FR ~ 7 L a ee ee KOK AK ROK ne undersi lg, 4 ‘ . MODUL yvenreve o @ . as om . a Anceased estate of 7.2-Giilespis pSoSer . f'¢ aee4 Dp ‘ . . £ ind acm Total xeceit the following as a full an ; 56 Longin mm WATT.Cw ING the personal property sing into his hands belonging OREDITED BY THe BCLLEH LAY ps L C had ass Saas — a 4 VOUCz VUW Set the said late %. . il j r fs ‘ lx ‘ ‘ AO + > s : » £ a ‘ < r « io iwelve snures of stock in the /irst “ational bank. D Mills and Cstwalt 58.8 ne helf interest in wheat binder i es Talley, professional Ly) K gervices 27.50 Cne third interest in wheat drill } SW acct 4.9 oe : jau and Brown for ucct. (ne dise herrow Naugh 5 Nov t . 1 UM Drug One hay rak LyOV. Troutman & CO. . | NY ‘ cA] a + (me drag harrow ) Nov. 20. F. x. Ostwalt ae Gat, 20th, 1922... Int services Dec. lst. a Collected faxes Landmark for Creditor's Notice 2 2eoples Loan Hartness,Clerk Superior Court Raymer ,att'y Interest on bank lartne r ae Total cune 30,1925. received ~rol aT = § yee ele Use + ‘ee ee 2 srcash n.administrator i Is ad Vast dadiinade dd ———$—— 1 = Qos elie S196 el GeSe ee wees. ceeewe eet ewe © vUulLy vV +} eee eek Le Ghee ee SES UN e Oct. 22nd. Oct. sord. liov. 4th. duly c<4th. feb. lithn,1920. fredell Cownty: a feb.z6tn. Dre »Ceidi tier Deuton, deceased ,submits the January c9the County tax 19ce sah cate i : ; ea 49 97 ‘ CO lds ad IC dead ; *ed. 26th. C.c.craig account & eee xrest on libery bonds wloetd ae sad ia apr. 27th. ae. vasn in bank 64.69 " em wledd.67 luterest on woe Q0.00 DeNe 114.95 ‘ : 4 6 +1) Yod eenevee 0f De , : ein Satrs oC ands aay 14th, lyedeces W n,1922 : 28 Balence in idministrators nus 20th, 1922. P. Le. x. Leuton,account 28.00 ; Pe LekieLouton - T ft ae ,to "sit - ( i. Lentz on tractor 183.33 paministrate J.Leveaton 2e Lentz,on tractcr 91.66 ‘ 2 whee , before me, ’ : subscribed and sworn to Interest on u.U.Lentz note 8.10 io ae ‘ 5 > May. 19206 lal ann : ' . Tn ie 1e 17th da of 148) i Balance on ..i15.Lentz note 88,24 his tne J , J. We Sharpe nterest on jj.ii. Lentz note od Dept. Ce we Ue Gh GR RENEE I he Balance on Interest on ‘i.\i.Lentz note . 7 av Aaminist? r O \f tinel settlement of “ed. he Brown,.dministrator of « y . - tA deceased, (wargaret I. Jonnston) il! Receipts. 1922 i June 16. savings account ‘irst Nationel Banx } } " " WMceoresville Uc tton liills note | : 17 Pension Jue 16 Interest on cotton mill note ) f } oral LBIYNT i ictal receipts } 4 ¥ 1] | | ‘ 2 ; vpisbursementse.e i 5 | at fi ) | ee 3.8 7 + (’ ‘ ’ cg . 4 | dune LOe veuiweital tness,C.u.C.cost OeSoO i i " 17 Mooresville Unterprise,notice 2.60 s. d.i'. Johnston, i} i } ane c “\/ Get. La xes for 1922 3,00 i} t | Z > 5 6 im raded ;cnool taxes for lY¥ce 5.46 1} LaUQC w & ae i) 1 Ai} ie mi Let LZ ke 1t Lic foot stones Lie OU iil i 7 +e 5H me Yi, ry xpenses 110.50 a ai H 1 i LU ee , e 4 aie = . gr i i June 16. 2.V.T.rlington,attorney 1¢e6e 00.00 ee : eeheiGd tne +0 »VevwewWe ,cost 5.64 iF ; v) d t . O 6 200 rcr Loe Ve 70 Y 1 ‘ 4 4° \ ; al t CNCOL Lag on WOU e 2 202 19 ve GeVV ; : : xv troy - 2°21 94 vr re CC 7800 oe BTOWN, GML. Of COMeyIeLe 14 Ye 46.09 ' 12% 4 A ’ 550 com. y183.47 d. 9.17 ’ ' 234 ee > + haem ; " dgonnnie znott williams distri vutive snares 97.57 ’ ' . ; alice uciieel 97.57 ' - 1 7 HS sUSS LE CwWrance Ite 00 ‘ ‘i = ; cannie opraker ; 97, ot ' 1 | , wil? 4 : Vises 1 " —o. tas ' on _f Vicia ~rown ’ a7. or § +) 9 Vr . yy, 4aulas, Ul Ours elmeiits oe) GoL~ 74 ak haine ” 2a 7 hwnd s " 1 tna on . Anreasnsea @ing eorce i. Brown, .dministrator cf iirs. J.s.dohnston,decease® © . a }\ sg + +1 Loan s ++ . s + +4 hn aceure te to the i sworn says thut the foregoing settlement is true ana accel best cf his knowledre,information and belief. | ) ie i s7B0 6 ‘ D sworn to and subscribed before me thi rr »oeV.Brown 4 Notary : Wy commission expires Jan.29th,19256,. audited und ap -roved, June 1920 J. os Hartness Gedo Ve RRERERKEREATE RETR ERE om ; the 16th day of June,19#%- eT Public «wate aie (NOTaRIAL + \*} a 3 * the following wn inv aa si ce 7 . af 1 2. ing is an inventory of the personal ¥* Operty) belong ing to the estate of Thos. &. ddkins.deceased.1: + ae , . 8 - «Gkins ,deceased,late of Iredell County, which came into the hands cf his admini strator: ) f > q mp mv ae tein wd ee he T 17, nsw 1ce ee ee ee ee ee ee ee ee ee ee ee ee ee 7 Life Insurance ----9--~-------------------------------------e, 977.77 r ile ie steele administrator. ~worn to before me, this 26th day of June ,19235, e ie Nar pe * Leputy Clerk 5. Yourt * SK SESE 6 SEE SK ORS oe EE RE * ¢ e J. B. Paurks,Executor of irs. o.8.uiise in account: with said estate on final settlement made June 21,1920. i eceipt Se rn } + a tT «+ 1991 1] V6 Com. Bank. GLeErtilicule, 114 lst,l9cl. wa tte Cash on hand ds LbOs 1G : moe area ©5.00 rPension money auge 1921 : z ee n 78/27 57.60 sale personalties LO/ ek . ae 1 sale land Sept.c0,1921 on [7 4 + CabB on hand from Way l/el timber séle Total assets: Credited by voucners: No.l. TVaxes 1921 Wa sé in rreditors & land Pe No.2 Notice to creaito Hn 5.30 . » . : 'T Aer / 10.00 No.S Bal. on coffin Nov.14/2h a Wie pr.0.R. Nicholson, lied. Bill . 8A T arpe auctioneer sept. ered " - 50 4, [22 28.00 No.6. JeW.Webb,Clerk in sale No.7. Barron s Conner, monument is oe fe O° ‘ 5 " §, J.eaHartness,C.s.C for 6/21/25 6 8 ' 50.00 " 9, W.D.furner,«ttorney . ‘ 6.55 No.10. Jed eHartness ,0+5-0- ae s eS O ( G L E 7 CY . en j Pe ta e in e s =. ee : ny Oe oa oO e of timber sold by deceased. 6% com. on yl4c4.62 v W wt 421.02 Bal. for distribution under will Special Vouchers: Myrtle lickay's interest 1/4 By check in full 6/21/23 Dorcas Clary's interest 1/4 By check & receipt in full jinfield liise's interest 1/4 By J. Hartness C.o.C.receipt. Winifield liise being deud & - no administrator qe *) Orren liise's interest. By Jeu. Hartness,C.»o.C.receipt, Crren luise being deud and no adminis- ll. Doreas Clary & layrtle lickey on account 513.81 y921.01 200. o Y 200. 25 200020 3230.25 4230.25 trator. June 21,1¥23( yobeblre, 200.25 A Aim, Auae Subscribed & sworn to June 21,1923. rm wan We SS larpe, Deputy Clerk Superior Court audited and approved June 21,1923. J. 4. Hartness C. De Us Executor PEO op oe OK 2B I IR KK KK ARK 2K 26 2K IK 2K JK OK 2K FR OR OR ROKR KKK IK 9K 2K IK KK 2K 9K 2K aK North Carolina, Iredell County. In the matter of the administration of the estate of C.L.Kistler deceased. Vv To J. «. Hartness,Clerk of the Superior Court of Iredell County: Take notice that the undersigned heirs at law of G.L.Kistler,deceased each renounces his cr her right to administer upon the estate of the estate of the said G.L.tistler,deceused, and respectfully asks that Se L.starr may be appointed as the administrator D.B.N. of said estate in his or her stead. This June lst,1926. annie smith r de Te Smita Naniie Kistler nD rs rr ~e » @ sedie Kistler Bettie Wnite G. Hoover noover 4 ) 1 the Superior Court Iredell County In the perior Cour In the matter of the Administration n a + ; ae Before Jen Hartness,0.5.0, G. L. X“istler, 4 A TT Kiatler fg A. L. Starr being sworn, doth say: That G.L.Kistler late of said +} na pT oo 4 - county is dead,leeving & will and testament, and that G.k.uestler, eines soo £47 cat ame Bxtr. of G.Lecestler,naving died without macing final settlement, is oo a 7 ein “a er ere ton 6.8 add Boll the proper person entitled to letters of sdministration C & BN } 5 ° T Tout] on the estate of tne said GeLecestler. Y . as 18 ,6r ined £ur t ti } V } sai S ta ve so far ano can be asce F her, hat the alue of s id es , € ta ‘ : ln © it of and that irs annie at the date of this application, 18 about 4500 ° a. sa Hoover are entitled as Smith,Mrs. Nannie Kestler ,wadie Kestler,sddie :oove > heirs and distributees thereof. Sworn to end gubseribed before me this 25th day of June ,1925. Je We snarpe,Dept.C. we C. Doreas Clary & lyyrtle iichey on account of timber" aa RI NE ELS RIN Te pe HON. 8. F. LONG HON. ZEB. V. | | RESIDENT JUDGE 167 JUDICIAL OIG TRICT f * % : SOLICITOR 1 61H JUDICIAL | STATESVILLE, N.C. ¥ STATESVILLE, N.C. 6% com. Oo OFMICE OR , | | , 4 CLERK SUPERIOR COURT | Q IREDELL COUNTY 1 }) | 3a1. for distrib van mal EDELL SUPERIOR COURTS. Monday before lst Monday in March. 2 J. A. HARTNESS, C : NEN ih Mendy she iat Howdy lay he 2 Weske Pi. J. W. SHARPE Hl v Si lcs cherishes Spb 2 wea — \ STATESVILLE, N. C. N Special Vo % No. 1. Myrtle Mex No. & Dorcas Cla No. 3. Winfield li > f J oo“ Har inifield no adminis ee a ne No. 4. Orren liise Hartness,C luise being trutore Ju j~ A § Ahan hn OLbLo haw Subscribed & swo pire eo we? de DeputycCler audited and appro Je es C. $57.56 Received of J.A.Hartness, Clerk Superior Court of Iredell County, N.C. the sum of Fifty-seven & 56/100 Dollars, the same being in full of my distributive share thro from the Mrs. -W.Mise, deceased my AA r aries I. Mise 8.E.,Mise estate. My Commission expires*%c ZZ LLG, yg Dear Sir:- Please go before Notary Public and sigh above receipt and have him sign and place his Notarial seal on same and then return to this office and I will mail you check for said amount. Very truly yours, J.AsHartness, Clerk Superior Court he estate of the is dead,leeving & will and of G.Lecestler,naving died oper person entitled to North Carolina, County. tter of the administration of the estate of C.L.cistler, , Hartness,Clerk of the superior Court of Iredell County: rice that the undersigned heirs at law of G.L.Kistler,deceased ~ 1ounces his cr her right to administer upon the estate of the if the said G.L.Xistler,decessed, and respectfully asks that irr may be appointed as the administrator D.B.N. of said nh his or her stead. 10 1lst,19206. annie Smith ds 7, Smith Naniie Kistler Be * Kistler sadie Kistler Bettie Wnite Mrs. Ce. G. Hoover Mr. C. G uoover County In the Superior Court » matter of the Bdministration of ) n ) / te © ) : 2 ; ae ) Before Jen Hartness,C.c.0, Kistler, ) being sworn doth say: That G.LeHistler late of said +e J* + ” a Starr } a. 7 sat =e testament, and that G.kR.cestler, without macing final settlement, is Dei’ letters of sdministration CoLetrek& + Lexestler. said s > o + ao lf 3 turther, that the value of said estate, Se far & , ig about 4200 and that irs. annie / / / jth,lMrs. Nannie Ars and distr 4 Sworn to end / tne date of this application, ie Kes } ie Hoover are entitled as Kestler ,vadle vestler,sddie 0 ibutees thereof. Starr i.e ste gubscribed before me this 25th day of June ,1920- DKK on a 2 RI KK IK IK IK KK 2K 2K KK 26 2K OK 2K FRR OR RR IK IRR KK IK IK 2 KK 6 26 aK aK aK snarpe,Dept.C- So Ve se can be ascertained Se ee a a 3 NG. iis Bal. for distribution under will Dorcas Clary & layrtle licxey on account of timber sold by deceased. ~275.00 y 421.02 6% com. on ¥14¢4.62 71.74 . " " £421.02 21<05 513.81 ~921.01 Special Vouchers: Ne. 1. Myrtle lickay's interest 1/4 230.25 1 } ‘ [© Ong On ‘ By check in full 6/21/22 yeS0~ 25 ° s N T nv ) * 5 Pat Ons Or » No. 2. Dorcas Clary's interest 1/4 200 e290 Y = : r ab By eneck receipt a7 als weo0en0 * U8es aa} ~ ar nm : ° : : aes { Om © » & No. 3. Viinfield iiise's interest 1/4 250.25 y By Jou. Hurtness C.u.C.receipt. \, | inifield lise being deud & a i i no administrator huh —“—) £230.25 \ thy, No. 4. Orren liise's interest. By Jeu. 250.25 ; Hartness,l..».C.receipt, Orren liise being deud and no adminis- ’ trutor. June 21,123 (boklelrn, 4250.25 t 4 rn Av Ly vV: Ohne Akay, yr Mirrg 21g OLL hrs J. B. Parks, Executor of 5.B.Mise Subscribed & sworn to June 21,1923. ariel J. ii, wnarpe, at ; Deputy Clerk Superior Court audited and approved dune 21,1923. J. &. Hartness Ue ~e C,. TR OIK oa RR IK KOK KR ACK OR 2K 0K ok 2k aK OK 2K FRO ROK IK KI KK IK J 1G KK KK aK aK a8 North Carolina, Iredell County. In the matter of the administration of the estate of C.L.kistler, deceased. To J. «a. Hartness,Clerk of the Superior Court of Iredell County: Take notice that the undersigned heirs at law of G.L.Listler,deceased each renounces his cr her right to administer upon the estate of the estate of the said G.L.vistler deceused, and respectfully asks that Ae L.Starr may be appointed as the administrator D.B.N. of suid estate in his or her stead. This June lst,19206. annie smith ve Da aa) Nani.ie Kistler B. 2. Kistler sadie Kistler Bettie Wnite Mrs. Ce Ge. noover My. C. Ge BOOVEr : , the Superior Court Iredell County In L 2 eas ea i In the matter of tne Ldministretion 0% . a 4 . ; : A me aphete 0° Before Jen Hartness,vVerev ' ) ) G. L. cxistler, N T Feat) + of 3g doth say: That G.LeHistler late oi said A. Le Starr being sworn, } x 4 .Y j wil ind tes ent, and that }R xnestler, county is dead,lesuving & will and testament, 1 : y ».s : ++) ay ent is J wane Aled without maxing final sevtlelieny, , y Cal atier.naving died without f Extr. of G.Lesestier,na £ 8 > -aministration CoDec& Beis the proper person entitled to letters of administra ‘ ‘ sat ler on the estate of tne said Ge Leucestlere ; ‘ ‘an be ascertaine } he value of seid estute, sc ( Murther, that the V i 1 200 and that rs. annie t t date of this application, 18 about 4500 and ‘ . & ne a nis 2 ; Z ‘estler ie Hoover are entitled as Smith,Mrs. Nannie Kestler ,wadie Kestler,ddie ee bh , “i a + dda ie heirs ‘ nd distributees thereof a 4 a ar VO rn t € } 8c I ore me eo ade St Y wv ) f 0 nd su seribed é 4 i=) this 25th day of June ,1926. a4 C J. We Shnarpe,Dept.l. »* %° state of North Caroline, SS.-In the Superior Court Iredell I, 4.L.ctarr, do solemnly swear (cor affirm) Tnat I believe that G.L.kistler died leaving a last Will and Testament, and that I will well and truly sdminister a@ll and singular the Goods and Chittels Ys nights und Credits cf the said G.Liestier,and e@ true and perfect inven- tory thereof returu as provided by law, and thet all other duties ap- pertaining tc the churge reposed in me, I will faitnfully and honestly skill and ability: So help me God. administrator + “1. ibscribed aud sworn to before tnais 25th day suction on dune Ballard over ALOOVEI ioover -Veaton oo ténley icover « Veaton Sarringer Les es GOrne lat Jefferson Bible Bunch of Bcroks Bunch of books Two. books Three Books Henry's Bible ~ Rs Rs a reek Bible ttarta } “ (iebster's Under A 4 books cnairs Snoe tc ols lietronome Bible Organ and 3 watches “yw 127 ow 25 50.00 10.20 WOOO eo .« Barringer administrator North Caroline, Iredell County In re: 1. .Shoemaker administrator ) ) BINAL ; of N.L.shoemuxer ,deceused ) m WY “yar YTD +> : TC a. ape HakTNESS, C LER CF SUrPERICR CCl The undersigned administrator submits the settlement of said estate: E IPT Cash on hand at time of death of deceased Cash in Commercial National Bank One liberty bond Le JeShoemaker note We P.Shoemeker,note Proceeds of sale of personal property House rent from Nov. lst,.19z1,to July $6.00 per month,being the same rate g4id house during the life of deceased to his death Proceeds of Jar .avings .tamps Total J.a.Hartness,letters of udministration Teleph ne messages at time of death Cleaning room and laundering bed clothes iC. Perry ,auctioneer ut sale lerk at sale _tatesville 2erinting Co.posters adv. sale Johnson Miller s‘une @l Co.,burial exp. s@lisbury Marble & Granite Co., monume County tates for 1941 City taxes for 1921 Dr. Gibson's account City of statesville, cemetary lot P.aeBoston,work on cemetary lot City tax for 1922 County tax for 1922 County tax for 1923 City tax for 1923 ons 7.#.ghoemaker ,admr., commissi on collections Court a $15.88 7.#,cnoemaker, amdr., commissions on disb. ; R.T.Weatherman, attorney fee Received of J,A,Hartness, Clerk Superior Court Thirteen & 88/100 Dollars J.aeHartness,C.S.C.for this settlement Ay the same being the distrbutive shares of Willie Bell Monday, minor; Bernice Monday, minor; Harold Monday, minor; and Thomas Monday, ‘ Total minor in the estate of N.! Inheritance tax on real estate L,Shoemaker deceased. (See order of Court in Special Proceeding Docket Book No. 13 for authority to pay this money Inheritance tax on personal property to the said 0,.S.Monday who is father and personal guardian for said Total children, This the 4 [i day of August, A.D, 1923, CS Wn lof Distributed as follows: Father and personat-tuerdian for said above named minors, ?.#.shoemaker, 1/6 Balance for distribution among heirs 9333.55 sarah Childers,1/6 olly iicLain, Warlin snoemexe Teddy snoemuker Resenndemuxer, Uella Barry Lessie srown Willie Bell wonday,1/4 of 1/4 cf 1/6 part pd. 045-60. aonday Harold Monday Thomas .ionday Ivey shoemexer 1/7 of pummey snoemmxkery Parks _noemeker Flake snhcemaker Jettie a haymond Shoemaker Emma Crouch 7.94 1otal G 338.55 T..choemaker oc dm. N.besneomaker,deceasede subscribed and swan to before me, this the 24th day of .ugust,1923. Jel e Ona pe Dept. Ue SeVe Statement of sale of property P. N. Bailey,tstate. July 2lst,192% sale price of property $25,000.00 Receipts for sale. Cash payment $6 ,250,00 Note-due Jan.#1,1924 4,687.50 i ' 4,687.50 4,687.50 4,687.50 » ani os 25, 00 Cash received from sale Lisbursement of cash received 6,250.00 us per detail below. City of Winston-calem street & sidewalk .ssessment wi »426.99 City of Winston-culem Cit; LX€ 20 215.18 J.3.McCreary-sheriff-Co. taxes 1923 124.57 Cobb-Noble Co.,Commission on s&éle 1,300.00 Wanly-Hendren & Womble Co.,legal f es 50.00 By balance to be distributed 3,133.26 O, 550.00 Bal. to be distributed as follows; 105.26 Connie dawn 3/42 Int. ,223.80 Janie Tharp si 226-80 J.'. Bailey 20-80 C.D.Bailey 225.60 veo. Bailey 220» 86 L. M.Taylor 220880 VMrs.C.B. Lanham 226.80 Mrs. UW. O. Cowan 220.60 irs. 4. J. Buchanan, 220260 #. H. Bailey 296.40 Rosa dvefferies 298.40 Mary Wiley 298.40 Fr c > ~ 6 ank Parker int. 74.62 Phil Purker Int. 74.62 Margaret Parker int. 74.62 ~ GOehLOSek COKCAGRECGGEGEGG CCOGEGEEEEGEBAGGE Inventory of Sale of personal property belonging to th 6 estate of W.d. Smith,dec'd sold by T.M.Smith,Sxr. Jan. 7th ,1919, Seythe &cradle $1.90,Bucket .03 ,harrow teeth .08 Steel tray, .50, andirons $1.70, dur, eO5, Barrell $1.00 saw .50, pitch fork & pot.21, plow .60, humes & traces .i5 Fro. $1.25, logchain ¥1.60,shovel, .10, bu. corn $1.10 Poultry wire .6,cultivator $3.00, chickens ¥1.05 hen .30 6 hens at 10 cts per 1b.y2.50, Ccox stove 43.00, pan .15 Coffee & can .02, lard $1.10,xettle, .06, pitch-fork .25 Doze Sppons .13, dishes, .10, dishes, 15, & dishes .61 Cups-saucers,4l dishes .46, six saucers .10, plates .10 Knives & forks .50, washpan .25, pitcher .10, pitcher .25 Five glasses, .30, glass-stand .¢5, jelly glasses je 2 glass pitchers. <0, bottles, 95. two crocks .40, jar .o Jug .265, two jars, wl.00,pan & bucket, 15, two crocks .70 Jug & vinegar,.25, two stew kettles .26, basxet .05 ldatech box, .07,0il-can and lantern ell,coffee mill .25 Brooms .20, spoons & fork, 07.pan & shovel,.39 shoe last .d0 Coffee pot & bread pan .40, rollin pin .40, dough board Oven, 11, stove pot .45, rolling pin. 08, sxillet 65 Two breud-gans,0&, sxillet 75, 2 lbs. sugar, 1s, coffee .2O 1.16 ; lour sifte 1 35 .85 vried fruit, 26, hooks & gnovel, 12, flour sifter .iV pun . Iron .21, kettle .55, five grain bags ¢1.44 three mugs 61 2.81 } 4 nh > 1ort 6 3. 4! Table cloth .16, safe #.1.75,dinging table §1.41,three mugs .61 44 Meal-chest .30,hut-ruck .15, thirteen fruit jars. 65 ; an zaches,15 ight fruit jars .ov 2 jers berries.17, two jara peaches,lo, eign Bowl & pitcher $1.76,table & gless.55,tuble cloth .10 i 6 lg & bottle .10 looking glass ell, books & thread .@6, bolls & otenat 35 glass .O 2 cups,& saucers .10, dish .30,vase .15, testament .o) GA8S ~ , ee x ts .05 busket .06, pitcher .05, glass-disn .25,bowl & contents 1 no t ( nix ) -n vase e15 Bowl .25,scissors & brush .6, toy .O7,marzos «Shen O.basket »26 Lamp .25,. box of tricks. 05,window-shades 40, basket ( 4t¢tcher .36,vase.20 Locks & bolts,11,lamp %1.50,g1as8 mug .05, sitcher ’ ‘ ) O.umbrella,.41 Pitcher .65,picture & frame -20, clock ¥1.50, ag 22.00 Counter pane ¢1.50,five quilts $5.25, coverlid we Qe 3e9 .15 Two quilts $1.75,four bed sheets $2.46,pillow case x tb 8.70 gack & pillow cases.25, four sete, gthier..oPae blanxets Pillow cases -06, three table cloths $1.11 two 30, toilets Bed sneet,25, pillow ghams.10, counter pane ’ 3. nov. 25,1922, J.W.Hager, note ee oe a as utes coh ee a 4. vec. 1st,1922. To sale list versonal Prop Quilt top .30, two oil cloths .56, counter pane $2.45 5. Nov. 26,1922. J.C.Redman,accoumt sed sheet .40, blanket $1.20, table .50, table clothe .15 26! 6. van. 2,1923,. U.S.Government war stamps matured Bed quilt ¢1.00, counter pane .51, blanket .50, curtains yl ved. 23.1923. JeWeLe Juilt y1.75, four pillows y1.56, four pillows ye. 60 uay 7 a ee Bed ~1.50, bed 45.60, two eotton beds $2.40, straw beds 9£.10 uay i me a a a bed steads 44.80, chest .25, rocking chair $3.00 8. accel ae i‘ oe - Votal charges 3 chairs »41, dre ser $10.20, dresser %5.25, spining w. y1.25 ieee anak uae a. 2 chairs 94.15, five chairs y6.31, broom .Ol, bed s. .10 1. vot. 27,1922 oa : eer e ° vcrawford- 5:9 lbs. corn yd.28, Jea.omith 5.1 Floyd swisner .50 iliiller : : runeral pin o % — : 2. Uct. 27,1922. J.a Hartness,l.5.C. 3. Oct. 27,1922 ithe Landmark,Nctice to Creditors 7 ae Me. Smith bxr. Of Jiedvecmitn,deceased. i ™ - 4. Vet. 29,1922. Boyer, Claywell,casxet 35.00 5. Nov. 10,1922. Landmark,Notice of sale 1.60 ibed before me, ae 6. wove. 25,1922. J.W Hager,store accte 7.25 @ 7. vece 1,1922. wu W-Dry,ducticneer fe sale 4.00 8. may 10,1922. vity texes 4.83 vece 1,1923. w.2.Dry,vierk pale versonal rroperty 1.50 vec. 1,1922. Mrs. isabell Harris acct. for Nursing 1,1922. Ue +e bry, vashier sale 8,1922. Express veW.Bagle personal effects 14,1922 vity and County taxes 10,1922. vlerk court,fees sale North Carolina In the Superior Court list Iredeil U unty re Before tne Clerk. 1,1926. vertified vopy Letters In the matter of W.a.Dry i matter of Wesa.Ddry, Administration DAT MTA ~ my > saTmM Pe administrato f p ee ) PabhTlaL ssTTLEMeNT. a ON Aang | a 27,1923. J» a. Hartness,vosts : of this gettlement 2.05 To ne > U Dé rsa n < . 4 the Superior Court of Iredeil County: 27,1926. tO my commissions on receipts, ~907.85 45.39 We be bry »dmi listraet« ) o- : vy inistrator of ».\i.Eagle,respectfully shows to the # Court the following : e following ss a just, true und perfect statement of his trans~ 27,1925. 10 my commissions om 9.46 disbursements .~189.40 actions as administrs istrator in the discharge i ischarge of his trust. 27,19236 John Ae Scott, atty. 30.00 ae yotel disbursements $ B6l.16 e 24,1922, Certificate of Depostt First Nat. Bank _ . No of yO NOV. £0,1922. Certificate of Ye posit Bank of stony Point ; Balance due the sstate ‘ vep. M & F, Bank, rent 5 ¢ ° %15.00 ie ADF 6 & F. Ban) Y AGmr. ts i. bagle 7 - 50.00 sworn to and subscribed before me 80.00 this the 27th day of July ,19235. - 00 ve We Sharpe lst. Nat. sank “Dept. clerk of superior court 1600 M& F. Bank 50.00 Examined,audited and approved and ordered lst. Nat. 20.00 filed. uhis the 27th day of vuly,1926. ~—. 2. too : — J. Ae Hartness " 80.0 Clerk »upericor vourt 30.00 41.10 i & FB. Bank= sale of house mrs. srown 1650.00 rent 100.00 Yst. Natfonal Benk 30.00 G@EGEE EGLEEGAEGGeeEeECEe GEEAECEESEEE CEGCEE 7ECEHOCS 3. vash-Hunter mfg. Lo. stock 2000.00 - " Rhodehiss Mill stock 2000.00 Dixie mill stock 2000.00 North Carolina - iredell County ee ‘ J. Ee. McKey, note 1000.00 snuual statement of account filed by umory L. Wilson,uxecutor of the Mrs. xoney " 100.00 estate of x. uw. Mckey, deceased. 4. E. Brown, acct. 13. 50 1921 neceipts. Mrs. cathey, acct. 34.86 Uct. 4, vep. li. & #. Bank Total receipts % 18269.21 " " " " " BY virst National bank- sele mill stock 510.22 : vr. taylor,med. acc t " - Bank = rent 43.00 " Bennett : «5,00 zo licoresville vrug vo. - ace t Lst. Nat. Bank rent 38.50 A " B. Me McNeely , undertaker “& #. Bank rent 20.75 : Kelly Clothing vo -ace t " ' 6.50 : B, M. McNeely ,undertexker ist. Nat'l, sank-sale house to ure wilson 1600.00 - ' * A. Ee Brown & CO- acc't " rent 60.00 Fe G. lis Kkpka, city tex Braded school tax lst. Nat. Bank, rent 75.00 Ba Nov. 17 sheriff alexander-state tax M& F. Bank " 35.00 " 29 K, Detiilson,nxece expense : : 50.00 J. Ee Powers-account ist. Nat. 25,00 ' ' OC. V. Voils-Notery &e fees M& #. Bank 45,00 lst. ’ r oo Bee's 50.00 L.P.Caston-labor 45.00 L.G.Beaver-labor igi Uhnarlotte M & Ce Ue monument oF Johnston & Cav in- {insurance 15. " This 1lOth J. a» Hartness,C.5.C., costs U.P.Mclleely- account J.aeBeGoodman, Notary fees Cash-urs. .B.Smith-stock 4s cash 1000.00 . Miss sugenia lickey-stock as cash 1000.00 Mrs. eLeWiilson stock as cash J. Me Modkey y Mrs. «. H. Roney " Mrs. oe se Srown " Jesse McXey- note as cash Mrs. Lester Cathey,stock us cash urs. i- Be. smith,sale of house iiss sugenia iicuey “ " ” Mrs. te Le Wilson Je M. licney Mrs. nu. He Koney lirwe o- Se Srown J. &. Mokey irs. Lester vCathney MYS. te Be Smith sale of house hiss uugenia “c*ey / i Mrs. uo. Le Wilson J, Me Mcney irs. x. He. Koney Mrse Ae Ge Brown J. lie McKey Mrs. Lester Cathey Total dis. YO balance day of vwctober 1922, 1000.00 1000.00 1000.00 1000.00 1000.00 1000.00 200.00 200.00 200.00 200.00 200.00 200.00 200.00 200.00 200.00 300.00 300.00 300.00 600.00 400.00 200.00 300.00 g 2914.95 454.26 »69~6 umery u. “ilson gxecutor Kk. W#. Mcsey GCOCEGES. COCR CERGRAAECOE CeGccacecesacccecacaanee 915, 069-21 One one Cne One INVENTORY OF THE PERSONAL ESTATE OF wHE LATE We. ii, COUreR, AND REAL EsTATE: dwelling on walnut street,iTays) stetesville,N.c. dwelling on rront ot. (Tays) statesville, N.C. dwelling on walnut ot. (Colverts) statesville,iN.Cc. farm 14 ,hiles out of town (Tays) 7 ¥1800.00 2800.00 2600.00 Cne tract of land,west of marion, N.C. 700.00 One tract of land Woolsey,n.U.(iMountain iract lz acres 1500.00 One lot water street, sasheville,n.Cc. 3500.00 rour stores, sast side of south venter otreet, ville, 4.C, 20,000.00 Two stores near depot, marion, ii.C. 6500.00 One tract in wioolse;,N.C.(Lookout rark tract about six acres) 400.00 m1 NAT DEADGLEDV wOMATR OF W es PERSONAL PRO Pant Y, tS TaTE Lf We Me BCNDS: AeT. & OeRailroad(Interest payable Cet.&april) mxpire 1916, Tre &.E.Graham Cotton mill, (interest Nove& May Expire 1908) 2000.00 U.s.S's GoldiInterest “eb. way ,august & Nov.op 10000,.00 ZIeb00.00OSO—™~*” Expire 1918 U 10 value Four shares Union xepublican no <25.00 uwo iredell uelephone e25 Twelve shares oélisbury Granite Co. (doubtful) no véiue wignty shares sirst National wank of statesvilile, NeCe NOTES: ". He Vanderford, (| Interest payable may & Nov. 6% 1250.00 due sept. 30th,1906 ) De Ac MIller, (Interest payable semi-annually 5110.26 6%)#eb. 8 &Asug.Sth. in each year vue three years. veo. H. Brown(Interest payable annually 6%) pue July 1st,1907 able semi-annuslly he Co Jackson, ( Interest pay 6%) vue aug. 1st,1908 -annus Ae Ce Jackson, (interest payable semi-annually 6%) vue Auge lst, 1909 $1000.00 S$. sternburg (Interest payable annuall 67%) Bonds 18500.00 vue “ane 1st,1908 stocks 8650.00 S$. Sternburg (Interest peyable annually 6%) Notes 17250.00 vue “an. lst,1909 1000.00 vertificates of deposit, 570,00 s. sternburg (Interest payable anuuelly 6%) Vash 139.72 Due van. lst,1910 1000.00 o&le of personal property 305.50 ve G. Swann (Interest payable annually 6%) on interest in business of weii.cooper & Co. 15000.00 Due seb. 26,1908 KKCAPLYULATICN: ve Geswann(Interest payable annusliy 6%) ' keal estate %39100.00 Due seb. 26,1909 250.00 4 nemainder of dower 4000.00 v. G owann (Interest payable annually 67) o Advancements 84000. 00 vue seb. 26,1910 : votal “FISE, CoE. Jas. a+ Butler(interest payable annually 6%) vue March 10th,1910 400.00 vue upon contract sale house and lot to w.¥.Love 2490.00 CERTIFICATES OF TIM’ VEPUSITE IN sHE #IRST NATIONAL BANK, STATESVILLE? N. C. ee er oe GUcGCOESOERECEIEELEEBLERS Gee One Certificate, may 4th,1907 500.00 CAPICIOTS? GASESGGAGUUSESCACE SE one vertificate, may 16th,1907 1000.00 une Certificate, may 20st, 1907 1000.00 une vertificate, vune lst, 1907 750.00 Final settlement of Clayton Davidson, administrator of lirs. Hebecce Une vertificate, vuly 16th,1907 2500.00 c Catherine Davidson, decessed. $5750. OO . 1921 Receipts Nov. Cash in Bank cash in sank, $130.52 ® Ministerial Kelief fund Cash on hand 9.20 . " Insurance money —jiz5. 72 4 " " " ' Bank note prin. and interest SALE OF PERSONAL PxUrsRTY, November 16th,1907 une bay horse 76.00 : gale of personal property One surry 85.00 ae Total receipts One buggy 32.00 Disbursements» $3.85 One iron safe 106.00 1921 Nov. 4. J. Ae Hartness,C-5-C.cost 6.50 : 2 Dec. 5 Note to Harris & Smith 2500 _ . 2.V.Turlington,atty- fee 10.00 she interest of w.m.Cooper in the business of W.W.Cooper & U0- Nov. 28.Bq M.Moleely funerel O*Ps Co. funeral 154.50 18.00 une set of buggy harness 170.00 Marion, M@vowell Lo., something over y15000.00 - " 7 Crawford-Bunoh Fre " Dr. GeW.Taylor, med. acct. 25.45 13.90 5 7 Long's Sanitorium 8 D. E.Turner & COs accte a ———— re een Mayhew, McNeely & Co. acct. %5.50 Inventory of the Estate of Mary L. Mott Barger Bros. acct. 21.00 Jewelry Mooresville Motor Co., acct. 18.60 Cash on hand Je We Neel, acct. 15.36 Keal estate Ramsey~Bowles M. Co. accte 25.00 W. N. Johnston sons Co. acct. 111.88 Henry Y. Mott, sr. Executor of mary L. Mott 5. J. P. Mills Co. acct. 188.72 May 5. We. We Rankin Company 56.60 " J, PB. Mills Co. , acct. 80.00 GEER no ERRGCRE CORRE R ORGS He eR EE april 22 E.C.Deaton,acct. 13,50 Nov. Clayton Davidson on commission 75.00 Nov. We We Rankin Co., acct. 18.50 The following is a complete inventory snd sale list of property " " it 6 re 70 belonging tc John Monday and sold by the undersigned afministr.tor on R.L.Poston,digging grave 8.00 Feb. 14,1921 and also a final settlement of the undersigned as such Mooresville vairy, acct. 7.19 administrator. irs. Nannie Brown, acct. 8.55 Ch harges Taxes for 1920 and 1921 for town 8.85 article Purcheser school taxes 4.22 1 hand saw J. a» Hartness,C.S.C.cost final settlement 8.55 1 hand saw Bill Patterson Clayton Davidson,sadmr. on Com. 22.96 1 square hammer $ Sbb1.09 Watch Lon Liteaker Claytong vavidson,Administrator being sworn says thet tne foregoing . Watch settlement is true and accurate to the vest of nis knowledge, information a Road cart Jane Sowers and belief. ‘ horse Fred H. Conger 90.00 Clayton We Davidson Total charges $113.85 Sworn to and subscribed before me this the 28th day of J ly,1925. se V. Brown .. 1921 Credited by following voucherse Notary Public. Feb. 14. Crawford-Bunch sur. Co. burial exp 925.60 (NOTARIAL SEAL) 26.00 J. DeHarkey on account " 21.00 " 3.85 Ja Hartness,C.5-Ce e Je Ae Scott, on account 2.00 68 Advertisement of gale 2 OCEEEEEEOELEA.COGEEA IB neer 1.50 CC OCOBEGE CE 6G UE CBEGES J. GeNichols, auctio et 2.50 7.00 7,00 Buren Jurney creditors notice, sentinel C.D.Moore, account Guss Fuller, account 5.00 D.L-Raymer, Attorney @. de Hartness,U.5-C. 5% Commissions on $113.85 Commission on disbursement Total sworn to und subscribed pefore me this the 7th day of July,1925. Je {ie Sner pe Dept. Ce we Ge The foregoing settlement of J.D. Harkey Administrator of John Munday ,deceased, together with his vouchers of disbursements having been audited and examined by me is hereby ap -roved, this 7th day of July ,1920. ee oe Hartness ‘Be Be Us CECEEGEE GGEEGERU CE ECOEESS GEvESEESEE CEOS GWE Ged CESUCS TATR OF } I STATE OF NORTH CaRCLIMa COUNTY OF IREDELL. Inventory of the personal property coming into my hands belonging to the estute of 2. lie Cline, deceased, and an estimate of tne value of the real estute belonging to the said estute of +. U.Cline, deceased. 1923 Way 4th - Yo cash on hand ut deuth of testator w79.25 lay 4th. ‘to cash in hands of i.C.#eimster,rustee, 584.00 liay 4th. One note on J.B.Houston of vate July 31,1922, due in 12 months trom date, secured by mortgage (This note is also in tne hands of i.C.Ffeimster, Lrustee ) May 4th. Houshold und kitchen furniture (estimated ) luay 4th. ‘lwo honses Way 4th. “arming utensils,including buggy and wagon Way 4th. One 014 automobile May 4th. rour hogs May 4th. wo cows May 4th. wheat about May 4th. fo cash from farmers’ Warehouse rent »65.00 Ww ° Real Estate. May 14th. io 84 acres, estimated value #8400.00 ie Jane ae Cline Executrix of the estate of LM. Cline, deceased. subscribed and sworn to beforeme, this the 24th day of July,ly23. 7 J. Sharpe Dept. Clerk superior Court GSSe GG Coe Lea ( @SCCCCEECEEECACE a eamenmntnained sik dace eka calgon Gon GEECEG GAEESECGE GEGOCECESUCECEREE Final settlement of C.S.3rawley,4dministrator of Jonas Yount ,deceased. 1920 RECEIPTS. bec. 7 Note collected 156.25 1921 i vec. 22. Balance vohn Brown note 544.30 1920 . July 1. interest 4.00 Total receipts 20 vISBURSEMENTS. Je 4 Hartness,U.5.C cost jiitness fees to prove will B.ld.lMoNeely & Co. acct N. Ge Moore, acct. Pletcher Undertaking 00+ L. H. Reavis,acct. Cash for bills Joa Hartnesa,.5.C.settlement C.S.Brawley,ix.5% sem on 9800.55 C.S.Brawley ,ux.57 COM. on 9163.85 Z.V.Turlington, atty fee Helen Yount note paid for her Helen Yount her part in full De de Hartness,C.0.Cefor minor children of John Yount, deceased, names-Lousetta Yount Palmer Yount, gen of Ag AS and Johnsie Yount, Karl Yount, son of John Yount by his receivt- votal disbursements Jonas Yount,executor being ig true and accurate to the best of his kno sworn says that the foregoing settlement wledge,information and belief, C. S- Brawley sworn to and subscribed before me this the lOth day of saugust,1925. $72 nee 7 4s y teal 4 f ee Fe leereur on ¢ ‘ i fee LMUVAR Aw et d Ae sf (v. t- y (7 List of articles sold John Johnson JeC Martin J.C. Martin R. 2. Craven Le Ae Stutts Je C. Martin Ge. We lictslLister Bud Foster A. & Durham Bud soster is. Le. Torrence T.S Jones Otho sart GeW.McAllister H.H.Daniel Je We. He. Johnsoi R. 2.Craven James Johnson James Johnson JC eMartin Glenn stutts ut public sale by 8. Ve Es CA 2 flea Sk fats bf Age &— Gn» - Daniel vrag harrower y1.00 rlows Gultivator Single tree rlows rlows cleavis ma ttock wire log chain drill mowing machine hay rake wood boards harrow harrow 1/4 inch ditch drag pot Mcteely hh jalg ese a vor | ghurs 11K Pe (NOTARIAL SEAL) (ol eran Sit7n FY ei a gy pri | if + kth KIER SSCGAGEEEAEGEEGUGEES Bvus LEP CQUAGEGECLEE 4 Ltd, ~ YW Qt brrrrr Marches “am'r of . satiate ecenac cen cnetaentaat Bob Brack C.B.Keynolds J.4. Brown Bud soster k.2.Craven H.H.Daniel H.u Smith J.C.Martin 4.4,.0urhem Je we Stutts J.Wi.H.Jonnson Jee Brown J.W.H.Johnson John Lotnery Le. Jd. Martin 1. J. ALexander x, P.Craven " " N.b.-Barnette «.L.Torrence H.H.Daniel Silas wcLaglin " " >.L. Bradshaw L.C Hollow L.C Hollow o A,LUrnen uet'.C, ristenbery ’. Lesumerow L.A.Stutts it. Ge. Rummage J. Le Ballard a. Younger Bob srack sarl archer J.4H. Johnson ue W McAllister J.C.Martin J.W.H. Johnson Hanna Sart C. M,. Johnson grind stone wash pot buggy harness breast chains wagon gears seddle forks cow chains roofing roofing guano scoop o 5 e 00 12.00 12.25 sarl Archer F. Rummage J.L.Ballerd warl archer Glenn atutts Glenn stutts pob prack bob Brack ve te Smith earl archer te L. Torrence Bob prack nitter #sortner nd uyman Kitter sortner sad uymen ne Leratterson sarl archer Kitter cortner Marvin callard Glenn otutts J.L.nallard Se a. Johnson he Le LOrrence " i H.H.vaniel sred xumuage ve we brown D>. a. Johnson JvJeiiet.vohngson Lester nannah Leseotutts U eli. Johnson voOhn sikes vlenn Stuttg a. L. Patterson C. M. Johnson shovel shovel kettle bucket bell bucket kettle bucket jars bucket dishes pan cupboard dishes pans pot kettle dishes brace « bits peck measure + bu. measure cupboard bbls.« d. board dishes pan lamp iron table cloth jag can Lester sanna KeaL.Dorrence w John Sikes U.M. Johnson J. L. Ballard Le. Ae Stutts &. L. Torrence Le Ae Stutts Bob brack Ge We McAllister ue. Le Torrence J. C. Martin S- A. Johnson John Sikes C. M. Johnson CG. M. Johnson Se A. Johnson Bud rogter n° L. Patterson Hitter sortner Wet.sortner WeE. Fortuer Gus vriffin 4&. oe Durham db. Ae JOhnson nk. L. Patterson mu. L.Torrence H. H. Daniel Lester Hanna -A.C.Younger " " H.C.Hollow weH.Fortner Je C. Martin Se Ae JOHnson fred numuege H.C.Hollow John sikes H. H. Daniel J.ii.H. Johnson le Se Stutts Bob Brack H. H. Daniel C. M. Johnson Bob Brack Je We. H. Johnson &. Le. Torrnece S- A. Johnson Lester Hanns £&. L. Torrence Ge WN. McAllister H. H. Daniel J. C. Martin We & Fortner Hannah Hart ue Le Torrence H. H. Daniel C. Younger Le Torrence M. Johnson M. Johnson L. Ballard Bud soster H. H. Daniel C. Me. Johnson w J. Le Ballard Bud soster curtain table milk can bbl square steeple plane saw nails drawing knife chisels towel chair wardrobe sacks clock chair basket glass guns pinchers andirons boots jug bed dresser sheots & towel pillows feather bed, etc. straw bed saw saw box nucket & sundries box steel yards sack sausage mill oil cans nails junk junk lap robe book box shoes wedge chairs box sash cheir can Builts cream separator beg shoes shoes pillows quilts clothes hats & caps shirt Quilt tazor strap watch hats & caps shirt quilt razor strap 225 40 025 1.50 5.0 - 50 200 10.25 6.55 - 60 65 045 210 290 280 1.00 » 20 75 » 60 10 45 025 025 %, ev 225 055 15 05 ~ 90 85 10 15 7.50 1.40 «10 2.25 «80 1.15 5.50 £200 10 275 Be 00 208 -10 75 ee s Daniel Johnson watch pants shirts coat shirt 55 50 50 30 25. 2.00 16.00 - 50 11.50 y Op6.c0 deceused being sworn. séys of ther personel property belonging seused es made on the day the sale on d accurete to tne best of his knowledge, informatione Se W. Daniel 900 2lst day of sept,19&c. C. P. Mcilieely rublic. Com. expires Nov. 4,192 CUGCEERECCEC CEES CER EEECE EGCCCCEGEE CE CEG GECE SEE baniel Jonnson watch pants shirts coat shirt pants 11.50 ¥ o6.85 deceused being sworn. s&ys of ther personel property belonging -eused es made on the day the sale on ‘J rete to tne best of his knowledge, informatione We Daniel 2lst day of sept,1922. - lictieely Notary vrublic. Com. expires Nov. 4,19226 CUCGHUC ECCS E CES CEE EBERLE EGCCUUEEEEC CE CEG GE COREG State of North Carolina Department of Archives and History Raleigh CERTIFICATE OF AUTHENTICITY This is to certify that the microphotographs appearing on this reel are true and accurate reproductions of the records listed on the target (title) sheet preceding each volume or series of records microfilmed hereon; that the records were microfilmed on the date and at the reduc- tion ratio indicated; and that on the date of microfilming, the records were in the custody of the official or other individual listed on the target sheet(s). It is further certified that the records listed on the aforesaid target sheet(s) were microfilmed in conformity with the provisions of Sections 8=45.1 — 8=45.4, General Statutes of North Carolina; and that in order to insure archival quality and authentic reproduction of records filmed, they were microfilmed in the manner prescribed,and with equipment and film approved, by the State Department of Archives and History. . 2 (Signed) fad WW’ eptta) ~ Seamera Operator Date ( ™ wd € END OF REEL